Incidental Mutation 'R3846:Gapvd1'
ID277361
Institutional Source Beutler Lab
Gene Symbol Gapvd1
Ensembl Gene ENSMUSG00000026867
Gene NameGTPase activating protein and VPS9 domains 1
Synonyms4432404J10Rik, 2010005B09Rik
MMRRC Submission 040894-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3846 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location34674594-34755232 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 34729072 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 96 (Y96*)
Ref Sequence ENSEMBL: ENSMUSP00000126225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028224] [ENSMUST00000102800] [ENSMUST00000113099] [ENSMUST00000142436]
Predicted Effect probably null
Transcript: ENSMUST00000028224
AA Change: Y96*
SMART Domains Protein: ENSMUSP00000028224
Gene: ENSMUSG00000026867
AA Change: Y96*

DomainStartEndE-ValueType
Pfam:RasGAP 152 353 2.3e-36 PFAM
internal_repeat_1 626 655 3.27e-5 PROSPERO
low complexity region 664 678 N/A INTRINSIC
internal_repeat_1 686 717 3.27e-5 PROSPERO
low complexity region 875 890 N/A INTRINSIC
low complexity region 909 920 N/A INTRINSIC
low complexity region 923 933 N/A INTRINSIC
low complexity region 936 952 N/A INTRINSIC
low complexity region 972 982 N/A INTRINSIC
VPS9 1332 1437 1.08e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102800
AA Change: Y96*
SMART Domains Protein: ENSMUSP00000099864
Gene: ENSMUSG00000026867
AA Change: Y96*

DomainStartEndE-ValueType
Pfam:RasGAP 152 353 2.3e-36 PFAM
internal_repeat_1 626 655 3.27e-5 PROSPERO
low complexity region 664 678 N/A INTRINSIC
internal_repeat_1 686 717 3.27e-5 PROSPERO
low complexity region 875 890 N/A INTRINSIC
low complexity region 909 920 N/A INTRINSIC
low complexity region 923 933 N/A INTRINSIC
low complexity region 936 952 N/A INTRINSIC
low complexity region 972 982 N/A INTRINSIC
VPS9 1332 1437 1.08e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113099
AA Change: Y96*
SMART Domains Protein: ENSMUSP00000108723
Gene: ENSMUSG00000026867
AA Change: Y96*

DomainStartEndE-ValueType
Pfam:RasGAP 152 353 2.8e-37 PFAM
internal_repeat_1 647 676 3.6e-5 PROSPERO
low complexity region 685 699 N/A INTRINSIC
internal_repeat_1 707 738 3.6e-5 PROSPERO
low complexity region 896 911 N/A INTRINSIC
low complexity region 930 941 N/A INTRINSIC
low complexity region 944 954 N/A INTRINSIC
low complexity region 957 973 N/A INTRINSIC
low complexity region 993 1003 N/A INTRINSIC
VPS9 1353 1458 1.08e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113103
SMART Domains Protein: ENSMUSP00000108727
Gene: ENSMUSG00000026867

DomainStartEndE-ValueType
Pfam:RasGAP 1 184 4.9e-32 PFAM
internal_repeat_1 484 513 1.18e-5 PROSPERO
low complexity region 522 536 N/A INTRINSIC
internal_repeat_1 544 575 1.18e-5 PROSPERO
low complexity region 733 748 N/A INTRINSIC
low complexity region 767 778 N/A INTRINSIC
low complexity region 781 791 N/A INTRINSIC
low complexity region 794 810 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137528
SMART Domains Protein: ENSMUSP00000120138
Gene: ENSMUSG00000026867

DomainStartEndE-ValueType
Pfam:RasGAP 15 216 1.2e-37 PFAM
internal_repeat_1 510 539 1.19e-5 PROSPERO
low complexity region 548 562 N/A INTRINSIC
internal_repeat_1 570 601 1.19e-5 PROSPERO
low complexity region 733 748 N/A INTRINSIC
low complexity region 767 778 N/A INTRINSIC
low complexity region 781 791 N/A INTRINSIC
low complexity region 794 810 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000142436
AA Change: Y96*
SMART Domains Protein: ENSMUSP00000126225
Gene: ENSMUSG00000026867
AA Change: Y96*

DomainStartEndE-ValueType
SCOP:d1wer__ 95 135 6e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169207
Meta Mutation Damage Score 0.63 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik A G 2: 35,354,558 Y261H probably damaging Het
Acad10 T A 5: 121,634,686 I511F probably benign Het
Adgb G A 10: 10,382,721 probably benign Het
Adgrg3 T C 8: 95,040,421 V468A probably benign Het
Ano4 A T 10: 88,995,252 I468N possibly damaging Het
Apool A T X: 112,364,458 probably benign Het
Arhgap32 T C 9: 32,190,024 V295A probably benign Het
Ccser2 A G 14: 36,940,288 V313A probably benign Het
Ctnnd1 T C 2: 84,616,927 I325V probably benign Het
Cubn T C 2: 13,283,008 D3420G probably damaging Het
Dnah12 A G 14: 26,710,211 T395A probably benign Het
Dock2 T G 11: 34,732,371 H65P possibly damaging Het
Fsip2 A T 2: 82,986,415 Q4164L possibly damaging Het
Gja3 T A 14: 57,035,704 K404* probably null Het
Gm10093 A G 17: 78,492,972 K464R possibly damaging Het
Gm9866 T A 12: 27,160,302 noncoding transcript Het
Hmcn2 A G 2: 31,430,350 I3948V possibly damaging Het
Hr C T 14: 70,571,453 R1090W probably damaging Het
Hrnr A G 3: 93,332,157 H3234R unknown Het
Ifi207 T A 1: 173,735,303 E92D probably benign Het
Iqgap2 G A 13: 95,673,678 probably benign Het
Itgax G T 7: 128,133,767 V273F probably damaging Het
Lamc3 A G 2: 31,924,592 M1043V probably benign Het
Lgmn T C 12: 102,404,329 N114S possibly damaging Het
Mov10l1 A G 15: 89,012,142 N678D possibly damaging Het
Nlrp9c A G 7: 26,382,276 probably null Het
Notch4 A G 17: 34,578,097 T940A probably damaging Het
Nudt15 T A 14: 73,523,471 Q60L probably benign Het
Olfr1118 T C 2: 87,309,182 V151A probably benign Het
Olfr676 T C 7: 105,035,689 C164R probably benign Het
Phip G A 9: 82,876,126 R1505* probably null Het
Ptger2 T G 14: 44,989,327 S121R probably damaging Het
Scyl2 A T 10: 89,640,541 F907L probably damaging Het
Trpc4 C A 3: 54,318,012 F843L probably benign Het
Tysnd1 C T 10: 61,696,088 S173L possibly damaging Het
Vmn2r124 T A 17: 18,073,691 V680D possibly damaging Het
Vmn2r91 G A 17: 18,107,598 V485I probably benign Het
Other mutations in Gapvd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Gapvd1 APN 2 34699860 missense probably benign 0.00
IGL00985:Gapvd1 APN 2 34695563 missense probably damaging 0.99
IGL01133:Gapvd1 APN 2 34725398 missense probably damaging 0.98
IGL01347:Gapvd1 APN 2 34706696 critical splice donor site probably null
IGL01830:Gapvd1 APN 2 34688956 missense probably benign 0.44
IGL01865:Gapvd1 APN 2 34695503 missense probably null
IGL02009:Gapvd1 APN 2 34704191 missense probably damaging 1.00
IGL02014:Gapvd1 APN 2 34704191 missense probably damaging 1.00
IGL02189:Gapvd1 APN 2 34728544 missense probably damaging 1.00
IGL02418:Gapvd1 APN 2 34730518 missense probably benign 0.00
IGL02632:Gapvd1 APN 2 34684174 splice site probably benign
IGL02636:Gapvd1 APN 2 34725404 missense probably benign 0.01
IGL02643:Gapvd1 APN 2 34704180 missense probably damaging 1.00
IGL03271:Gapvd1 APN 2 34727207 unclassified probably benign
P0023:Gapvd1 UTSW 2 34706688 splice site probably benign
R0016:Gapvd1 UTSW 2 34699913 splice site probably benign
R0016:Gapvd1 UTSW 2 34699913 splice site probably benign
R0029:Gapvd1 UTSW 2 34678141 missense probably damaging 1.00
R0029:Gapvd1 UTSW 2 34678141 missense probably damaging 1.00
R0282:Gapvd1 UTSW 2 34688960 nonsense probably null
R0414:Gapvd1 UTSW 2 34693427 missense probably benign 0.14
R0443:Gapvd1 UTSW 2 34704621 intron probably benign
R0542:Gapvd1 UTSW 2 34725036 unclassified probably benign
R0570:Gapvd1 UTSW 2 34728540 missense probably damaging 1.00
R0840:Gapvd1 UTSW 2 34729113 missense probably benign 0.29
R0866:Gapvd1 UTSW 2 34709217 missense probably damaging 1.00
R0890:Gapvd1 UTSW 2 34712317 missense probably damaging 1.00
R0926:Gapvd1 UTSW 2 34712325 missense probably damaging 1.00
R0970:Gapvd1 UTSW 2 34730613 unclassified probably null
R1168:Gapvd1 UTSW 2 34704469 missense probably damaging 1.00
R1391:Gapvd1 UTSW 2 34706802 missense probably damaging 1.00
R1577:Gapvd1 UTSW 2 34709228 missense probably damaging 1.00
R1585:Gapvd1 UTSW 2 34712195 missense possibly damaging 0.93
R1669:Gapvd1 UTSW 2 34730682 critical splice acceptor site probably null
R1677:Gapvd1 UTSW 2 34700761 critical splice donor site probably null
R1812:Gapvd1 UTSW 2 34725064 nonsense probably null
R1874:Gapvd1 UTSW 2 34706021 missense probably damaging 1.00
R1878:Gapvd1 UTSW 2 34725200 missense probably benign 0.00
R1974:Gapvd1 UTSW 2 34700841 missense probably damaging 0.99
R2111:Gapvd1 UTSW 2 34684317 missense probably benign 0.08
R2921:Gapvd1 UTSW 2 34688863 missense probably damaging 0.97
R2923:Gapvd1 UTSW 2 34688863 missense probably damaging 0.97
R3894:Gapvd1 UTSW 2 34728476 missense probably benign 0.23
R4405:Gapvd1 UTSW 2 34728735 missense probably damaging 1.00
R4605:Gapvd1 UTSW 2 34728537 missense probably damaging 1.00
R4770:Gapvd1 UTSW 2 34691181 missense probably damaging 0.98
R4935:Gapvd1 UTSW 2 34704492 nonsense probably null
R5218:Gapvd1 UTSW 2 34728476 missense probably benign 0.23
R5490:Gapvd1 UTSW 2 34693433 missense probably benign 0.23
R5571:Gapvd1 UTSW 2 34715253 missense probably damaging 1.00
R5588:Gapvd1 UTSW 2 34709154 missense probably damaging 1.00
R5933:Gapvd1 UTSW 2 34684291 missense probably benign 0.27
R6117:Gapvd1 UTSW 2 34690459 splice site probably null
R6661:Gapvd1 UTSW 2 34728438 missense probably damaging 1.00
R6857:Gapvd1 UTSW 2 34728377 missense probably damaging 1.00
R6950:Gapvd1 UTSW 2 34684245 missense probably benign 0.04
R7009:Gapvd1 UTSW 2 34700817 missense probably damaging 1.00
R7125:Gapvd1 UTSW 2 34695600 missense probably benign
R7154:Gapvd1 UTSW 2 34725063 missense probably damaging 1.00
R7316:Gapvd1 UTSW 2 34704669 missense probably damaging 1.00
R7358:Gapvd1 UTSW 2 34690461 critical splice donor site probably null
R7363:Gapvd1 UTSW 2 34712195 missense probably benign 0.01
R7371:Gapvd1 UTSW 2 34717373 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCCTCTCCTCAAAAGGCGC -3'
(R):5'- CAAGGAGATGTCACTGTTGGCAC -3'

Sequencing Primer
(F):5'- CAATCAAGTATCGTAAAACCTGAAGG -3'
(R):5'- CTGTTGGCACAGTAATGAACTC -3'
Posted On2015-04-06