Incidental Mutation 'R3884:Prss44'
ID310595
Institutional Source Beutler Lab
Gene Symbol Prss44
Ensembl Gene ENSMUSG00000032493
Gene Nameprotease, serine 44
Synonyms1700036D21Rik, TESSP4
MMRRC Submission 040797-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R3884 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location110813994-110824523 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110814696 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 136 (I136T)
Ref Sequence ENSEMBL: ENSMUSP00000117039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098345] [ENSMUST00000141089] [ENSMUST00000198815]
Predicted Effect probably benign
Transcript: ENSMUST00000098345
AA Change: I136T

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000095948
Gene: ENSMUSG00000032493
AA Change: I136T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Tryp_SPc 111 340 1.17e-84 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000141089
AA Change: I136T

PolyPhen 2 Score 0.627 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117039
Gene: ENSMUSG00000032493
AA Change: I136T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Trypsin 112 144 1.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196597
Predicted Effect probably benign
Transcript: ENSMUST00000198815
SMART Domains Protein: ENSMUSP00000142633
Gene: ENSMUSG00000032493

DomainStartEndE-ValueType
Tryp_SPc 3 115 2.6e-5 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 G A 15: 98,597,174 S719F probably benign Het
Als2 A G 1: 59,185,568 V998A probably damaging Het
Ankmy1 T G 1: 92,886,152 E435A probably damaging Het
Ankrd52 A G 10: 128,388,955 E820G probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp6v0d2 T A 4: 19,910,677 D71V probably damaging Het
C3 T C 17: 57,217,173 probably null Het
Cnot7 A T 8: 40,510,130 M1K probably null Het
Cntn2 A G 1: 132,528,939 V123A probably damaging Het
Depdc5 G A 5: 32,944,077 E904K probably damaging Het
Dip2c G T 13: 9,551,858 L284F probably damaging Het
Epb41l3 C T 17: 69,274,116 R552* probably null Het
Gabra4 T C 5: 71,657,257 D40G probably benign Het
Gm9925 T C 18: 74,065,328 probably benign Het
Igf2r T A 17: 12,709,468 Q996L probably benign Het
Klk1b16 T C 7: 44,139,463 V40A possibly damaging Het
Lin9 G T 1: 180,688,065 G427* probably null Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACA 12: 40,185,261 probably null Het
Lyg2 C G 1: 37,910,069 A71P probably damaging Het
Mycbp2 A C 14: 103,295,250 L390V probably damaging Het
Myl3 A G 9: 110,767,959 H129R probably damaging Het
Naa16 T C 14: 79,343,262 K604R probably damaging Het
Nedd4 C T 9: 72,725,077 P398S probably benign Het
Neurl1a T C 19: 47,253,446 V309A probably benign Het
Olfr714 A T 7: 107,073,903 Q25L possibly damaging Het
Olfr800 T C 10: 129,660,538 V244A probably damaging Het
Pacs1 T C 19: 5,155,759 Y301C probably damaging Het
Parl A T 16: 20,283,012 M90K probably damaging Het
Plxnc1 A T 10: 94,910,687 probably null Het
Prkd2 C A 7: 16,853,255 S375R probably benign Het
Rock1 G A 18: 10,122,768 T351I probably damaging Het
Selenon T C 4: 134,539,770 N507S possibly damaging Het
Slc38a7 C T 8: 95,846,181 G141R probably damaging Het
Trpm4 C T 7: 45,321,998 probably null Het
Ttn T A 2: 76,730,361 N27486I probably damaging Het
Xylb T C 9: 119,380,687 M346T probably damaging Het
Zbtb17 T C 4: 141,464,575 F306L probably damaging Het
Other mutations in Prss44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00469:Prss44 APN 9 110815489 missense probably benign 0.04
IGL01647:Prss44 APN 9 110814677 missense probably damaging 1.00
IGL02174:Prss44 APN 9 110817131 missense probably damaging 1.00
R1800:Prss44 UTSW 9 110817204 missense probably damaging 1.00
R1858:Prss44 UTSW 9 110814109 missense probably benign 0.44
R6638:Prss44 UTSW 9 110817203 missense probably damaging 1.00
R6746:Prss44 UTSW 9 110815293 makesense probably null
R7267:Prss44 UTSW 9 110816543 missense probably damaging 0.99
R7332:Prss44 UTSW 9 110815462 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCAGGTTGTGAGGATCTG -3'
(R):5'- AAACCTGGGAGTGTCATCTTGTG -3'

Sequencing Primer
(F):5'- TGAGGATCTGGCGGGTG -3'
(R):5'- TGGCCTGGAAACTCACTATG -3'
Posted On2015-04-17