Incidental Mutation 'R3956:Rasgrf2'
ID310719
Institutional Source Beutler Lab
Gene Symbol Rasgrf2
Ensembl Gene ENSMUSG00000021708
Gene NameRAS protein-specific guanine nucleotide-releasing factor 2
SynonymsGrf2, 6330417G04Rik
MMRRC Submission 040833-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.300) question?
Stock #R3956 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location91880400-92131656 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91982855 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 696 (S696P)
Ref Sequence ENSEMBL: ENSMUSP00000096930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099326]
Predicted Effect probably damaging
Transcript: ENSMUST00000099326
AA Change: S696P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708
AA Change: S696P

DomainStartEndE-ValueType
PH 23 135 1.29e-16 SMART
IQ 204 226 1.3e0 SMART
RhoGEF 247 428 2.2e-51 SMART
RasGEFN 633 775 9.35e-15 SMART
RasGEFN 786 923 6.04e-9 SMART
RasGEF 949 1186 2.97e-112 SMART
Predicted Effect unknown
Transcript: ENSMUST00000142378
AA Change: S95P
SMART Domains Protein: ENSMUSP00000115401
Gene: ENSMUSG00000021708
AA Change: S95P

DomainStartEndE-ValueType
RasGEFN 33 175 9.35e-15 SMART
Blast:RasGEFN 187 249 8e-29 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000151408
AA Change: S95P
SMART Domains Protein: ENSMUSP00000116892
Gene: ENSMUSG00000021708
AA Change: S95P

DomainStartEndE-ValueType
RasGEFN 33 175 9.35e-15 SMART
RasGEFN 186 323 6.04e-9 SMART
RasGEF 349 586 2.97e-112 SMART
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik A G 13: 58,384,389 S118P probably damaging Het
9330159F19Rik A G 10: 29,224,809 K393E possibly damaging Het
Aagab A G 9: 63,619,160 E155G probably damaging Het
Abca16 A G 7: 120,527,752 N1221S probably damaging Het
Acad11 A G 9: 104,086,152 probably benign Het
Acsl1 T A 8: 46,534,458 L693Q probably damaging Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
B3gat1 A G 9: 26,757,028 T305A possibly damaging Het
BC051076 A G 5: 87,964,251 noncoding transcript Het
Ccni A G 5: 93,183,404 L236S probably damaging Het
Cdc45 A G 16: 18,805,430 V119A probably benign Het
Clspn ACGGCGGCGGC A 4: 126,566,437 probably null Het
Creld1 A G 6: 113,492,229 D340G possibly damaging Het
Dnah2 T A 11: 69,484,021 I1417L probably benign Het
Efhc1 A C 1: 20,978,666 K434N probably damaging Het
Evi5l T C 8: 4,191,358 V297A possibly damaging Het
Fam49b T C 15: 63,941,974 Y158C probably damaging Het
Fam58b C A 11: 78,751,023 E214* probably null Het
Fam69b C T 2: 26,635,567 P171L probably benign Het
Fkbp8 T G 8: 70,534,867 S376A probably damaging Het
Gfod1 A T 13: 43,201,062 C146S probably damaging Het
Gm8882 G T 6: 132,361,851 Q135K unknown Het
Gm960 T A 19: 4,692,497 T214S probably benign Het
Greb1 G T 12: 16,682,299 P1554T probably damaging Het
Grip1 A T 10: 119,930,026 I88F probably damaging Het
Hbq1a T C 11: 32,300,214 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kmt2e A G 5: 23,496,025 T121A probably benign Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Mfsd2b A T 12: 4,866,848 F194Y probably damaging Het
Mtmr3 A T 11: 4,491,138 V504E probably damaging Het
Neb C T 2: 52,201,963 V5030M possibly damaging Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Olfr1039 C T 2: 86,131,019 V215I probably benign Het
Olfr1042 A G 2: 86,159,938 V144A probably benign Het
Olfr199 G A 16: 59,216,065 Q183* probably null Het
Pmfbp1 A G 8: 109,530,169 S502G probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ralgapa2 C T 2: 146,435,964 V426I probably damaging Het
Riok3 T A 18: 12,142,974 Y242* probably null Het
Robo2 T G 16: 73,961,867 Y672S probably damaging Het
Rsbn1 A G 3: 103,928,675 H343R probably damaging Het
Sar1a A T 10: 61,686,393 N88I possibly damaging Het
Sgcz A G 8: 37,526,192 probably benign Het
Tbc1d9 C T 8: 83,233,532 T138I probably damaging Het
Tex37 A G 6: 70,913,485 Y108H possibly damaging Het
Tmem131l C A 3: 83,910,419 C1257F probably damaging Het
Tmem136 C A 9: 43,111,513 C182F probably damaging Het
Ttn A G 2: 76,969,249 V429A possibly damaging Het
Umodl1 A G 17: 31,002,863 T1280A probably benign Het
Xpnpep3 A G 15: 81,451,029 probably benign Het
Other mutations in Rasgrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Rasgrf2 APN 13 92022917 splice site probably benign
IGL01358:Rasgrf2 APN 13 91982630 missense probably benign 0.23
IGL01666:Rasgrf2 APN 13 92038210 missense probably damaging 1.00
IGL01930:Rasgrf2 APN 13 91982738 missense probably damaging 0.98
IGL02230:Rasgrf2 APN 13 91988026 missense probably damaging 1.00
IGL02630:Rasgrf2 APN 13 92131392 missense probably damaging 1.00
IGL02690:Rasgrf2 APN 13 92030765 missense probably damaging 1.00
IGL02943:Rasgrf2 APN 13 91983633 missense probably damaging 1.00
IGL03067:Rasgrf2 APN 13 92022905 missense probably damaging 0.97
IGL03342:Rasgrf2 APN 13 91987979 missense probably damaging 1.00
IGL03405:Rasgrf2 APN 13 91896051 missense probably damaging 1.00
R0620:Rasgrf2 UTSW 13 91919817 splice site probably benign
R0632:Rasgrf2 UTSW 13 91972274 missense probably benign 0.00
R0894:Rasgrf2 UTSW 13 91982771 missense probably damaging 1.00
R1354:Rasgrf2 UTSW 13 92028666 missense probably damaging 1.00
R1400:Rasgrf2 UTSW 13 91887689 missense probably damaging 1.00
R1437:Rasgrf2 UTSW 13 92030888 missense probably damaging 1.00
R1443:Rasgrf2 UTSW 13 91983676 missense probably damaging 1.00
R1522:Rasgrf2 UTSW 13 91896086 missense probably benign 0.00
R1553:Rasgrf2 UTSW 13 91890664 missense probably damaging 1.00
R1613:Rasgrf2 UTSW 13 91902621 missense probably damaging 1.00
R1883:Rasgrf2 UTSW 13 91969030 missense probably benign
R1934:Rasgrf2 UTSW 13 91983706 splice site probably null
R1990:Rasgrf2 UTSW 13 92035965 missense probably damaging 1.00
R2037:Rasgrf2 UTSW 13 91902629 missense probably damaging 0.99
R2043:Rasgrf2 UTSW 13 92030843 missense possibly damaging 0.91
R2135:Rasgrf2 UTSW 13 91972255 missense probably benign
R2193:Rasgrf2 UTSW 13 92023713 splice site probably null
R2406:Rasgrf2 UTSW 13 91972240 missense probably benign
R3055:Rasgrf2 UTSW 13 92029075 missense probably damaging 1.00
R3916:Rasgrf2 UTSW 13 92030788 missense probably damaging 1.00
R3954:Rasgrf2 UTSW 13 91982855 missense probably damaging 0.98
R3955:Rasgrf2 UTSW 13 91982855 missense probably damaging 0.98
R4133:Rasgrf2 UTSW 13 91982654 missense possibly damaging 0.59
R4177:Rasgrf2 UTSW 13 91890598 missense probably damaging 1.00
R4178:Rasgrf2 UTSW 13 91890598 missense probably damaging 1.00
R4357:Rasgrf2 UTSW 13 91890677 missense probably damaging 1.00
R4358:Rasgrf2 UTSW 13 91890677 missense probably damaging 1.00
R4359:Rasgrf2 UTSW 13 91890677 missense probably damaging 1.00
R4439:Rasgrf2 UTSW 13 91983678 missense possibly damaging 0.95
R4440:Rasgrf2 UTSW 13 91983678 missense possibly damaging 0.95
R4441:Rasgrf2 UTSW 13 91983678 missense possibly damaging 0.95
R4564:Rasgrf2 UTSW 13 91885654 nonsense probably null
R4576:Rasgrf2 UTSW 13 91896410 missense possibly damaging 0.58
R4590:Rasgrf2 UTSW 13 92038281 missense probably damaging 1.00
R4718:Rasgrf2 UTSW 13 91990830 critical splice donor site probably null
R4778:Rasgrf2 UTSW 13 91983661 missense probably damaging 0.99
R4790:Rasgrf2 UTSW 13 91988016 missense probably damaging 1.00
R4808:Rasgrf2 UTSW 13 92023682 missense probably damaging 1.00
R5151:Rasgrf2 UTSW 13 91896036 missense probably damaging 1.00
R5286:Rasgrf2 UTSW 13 92131433 missense possibly damaging 0.94
R5902:Rasgrf2 UTSW 13 91919892 missense probably damaging 1.00
R6180:Rasgrf2 UTSW 13 92029101 missense probably damaging 1.00
R6264:Rasgrf2 UTSW 13 92030785 missense probably damaging 1.00
R6369:Rasgrf2 UTSW 13 92131446 missense probably benign
R6428:Rasgrf2 UTSW 13 91987981 missense probably damaging 1.00
R6595:Rasgrf2 UTSW 13 92030853 missense probably damaging 1.00
R6619:Rasgrf2 UTSW 13 92028519 missense probably damaging 1.00
R6988:Rasgrf2 UTSW 13 91885635 missense probably benign 0.02
R7026:Rasgrf2 UTSW 13 91983613 missense probably damaging 1.00
R7038:Rasgrf2 UTSW 13 91982833 missense possibly damaging 0.95
R7045:Rasgrf2 UTSW 13 92022592 intron probably benign
R7056:Rasgrf2 UTSW 13 92030695 missense probably damaging 0.99
R7058:Rasgrf2 UTSW 13 91886402 missense probably damaging 0.99
R7256:Rasgrf2 UTSW 13 91884518 nonsense probably null
R7392:Rasgrf2 UTSW 13 91893737 missense
X0013:Rasgrf2 UTSW 13 92030855 missense probably damaging 1.00
X0026:Rasgrf2 UTSW 13 91902535 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGTCAGGTCCAAGGCTCCAATC -3'
(R):5'- ACTCCTTAGTGGCAAGGGAC -3'

Sequencing Primer
(F):5'- AAGGCTCCAATCCTTGAGTTC -3'
(R):5'- AGATGGCCTGGACAGTGTC -3'
Posted On2015-04-29