Incidental Mutation 'R4564:Rasgrf2'
ID343257
Institutional Source Beutler Lab
Gene Symbol Rasgrf2
Ensembl Gene ENSMUSG00000021708
Gene NameRAS protein-specific guanine nucleotide-releasing factor 2
SynonymsGrf2, 6330417G04Rik
MMRRC Submission 041789-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R4564 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location91880400-92131656 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 91885654 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 544 (Q544*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099326]
Predicted Effect probably null
Transcript: ENSMUST00000099326
AA Change: Q1145*
SMART Domains Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708
AA Change: Q1145*

DomainStartEndE-ValueType
PH 23 135 1.29e-16 SMART
IQ 204 226 1.3e0 SMART
RhoGEF 247 428 2.2e-51 SMART
RasGEFN 633 775 9.35e-15 SMART
RasGEFN 786 923 6.04e-9 SMART
RasGEF 949 1186 2.97e-112 SMART
Predicted Effect probably null
Transcript: ENSMUST00000151408
AA Change: Q544*
SMART Domains Protein: ENSMUSP00000116892
Gene: ENSMUSG00000021708
AA Change: Q544*

DomainStartEndE-ValueType
RasGEFN 33 175 9.35e-15 SMART
RasGEFN 186 323 6.04e-9 SMART
RasGEF 349 586 2.97e-112 SMART
Meta Mutation Damage Score 0.544 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atad3a C T 4: 155,747,309 probably null Het
Bach2 T G 4: 32,563,338 S602A probably damaging Het
Ccl19 G T 4: 42,756,295 S12R probably damaging Het
Cfap54 T C 10: 92,839,540 probably benign Het
Cndp1 T A 18: 84,622,286 I265F probably damaging Het
Cnot3 G A 7: 3,653,258 R181H probably damaging Het
Dicer1 T A 12: 104,704,751 K1011* probably null Het
Dip2b G A 15: 100,157,258 W99* probably null Het
Fam129c T C 8: 71,605,060 probably benign Het
Fpr-rs6 A T 17: 20,182,906 Y64* probably null Het
Fubp1 C A 3: 152,222,936 Y480* probably null Het
Gfra1 T C 19: 58,239,250 probably null Het
Gm10770 T C 2: 150,178,911 T229A probably benign Het
Gm826 A C 2: 160,311,993 probably benign Het
Gpd2 G A 2: 57,307,083 V217I possibly damaging Het
Hectd4 T C 5: 121,350,431 I3595T probably benign Het
Lmln A G 16: 33,109,856 E561G probably benign Het
Lrrc71 T A 3: 87,745,408 probably benign Het
Man2a2 T A 7: 80,368,838 Y91F probably benign Het
Map4k4 A G 1: 39,988,975 T319A probably damaging Het
Mcm6 G T 1: 128,343,459 H474Q probably damaging Het
Mn1 C G 5: 111,420,667 N834K possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Npas2 A G 1: 39,287,566 D44G probably damaging Het
Npc1 C T 18: 12,191,732 G1235R probably damaging Het
Olfml2a C T 2: 38,960,294 T674I probably benign Het
Olfr1311 A G 2: 112,021,767 L29P possibly damaging Het
Plxnb1 C T 9: 109,113,420 A1779V probably benign Het
Ppil3 T A 1: 58,431,322 D123V probably damaging Het
Prr23a3 A G 9: 98,865,137 E48G probably damaging Het
Prr5l T C 2: 101,746,749 E110G probably damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
R3hdm1 C T 1: 128,221,659 T839M probably benign Het
Riok3 C A 18: 12,148,879 R302S probably damaging Het
Rnf145 A G 11: 44,548,808 K144E probably benign Het
Sin3b A C 8: 72,753,581 T904P probably damaging Het
Skint4 C T 4: 112,119,869 T152M probably damaging Het
Slc22a2 A G 17: 12,610,056 I350V probably benign Het
Slc6a11 G T 6: 114,131,362 G29V probably benign Het
Speg A C 1: 75,391,834 H676P probably damaging Het
St6gal2 T A 17: 55,482,647 H227Q probably damaging Het
Strn3 A G 12: 51,633,621 S399P probably benign Het
Tbc1d1 A G 5: 64,173,484 E2G probably damaging Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tmem8 A G 17: 26,117,863 R252G possibly damaging Het
Trpm6 T C 19: 18,832,597 L1119P possibly damaging Het
Upf2 A C 2: 6,027,312 T890P unknown Het
Upk1b T A 16: 38,780,107 K170N probably benign Het
Vmn1r78 A T 7: 12,152,558 Y32F probably damaging Het
Vps11 A G 9: 44,361,597 F12S probably damaging Het
Zfp318 T A 17: 46,412,815 C1915S possibly damaging Het
Zfp346 A C 13: 55,113,707 R103S probably damaging Het
Other mutations in Rasgrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Rasgrf2 APN 13 92022917 splice site probably benign
IGL01358:Rasgrf2 APN 13 91982630 missense probably benign 0.23
IGL01666:Rasgrf2 APN 13 92038210 missense probably damaging 1.00
IGL01930:Rasgrf2 APN 13 91982738 missense probably damaging 0.98
IGL02230:Rasgrf2 APN 13 91988026 missense probably damaging 1.00
IGL02630:Rasgrf2 APN 13 92131392 missense probably damaging 1.00
IGL02690:Rasgrf2 APN 13 92030765 missense probably damaging 1.00
IGL02943:Rasgrf2 APN 13 91983633 missense probably damaging 1.00
IGL03067:Rasgrf2 APN 13 92022905 missense probably damaging 0.97
IGL03342:Rasgrf2 APN 13 91987979 missense probably damaging 1.00
IGL03405:Rasgrf2 APN 13 91896051 missense probably damaging 1.00
R0620:Rasgrf2 UTSW 13 91919817 splice site probably benign
R0632:Rasgrf2 UTSW 13 91972274 missense probably benign 0.00
R0894:Rasgrf2 UTSW 13 91982771 missense probably damaging 1.00
R1354:Rasgrf2 UTSW 13 92028666 missense probably damaging 1.00
R1400:Rasgrf2 UTSW 13 91887689 missense probably damaging 1.00
R1437:Rasgrf2 UTSW 13 92030888 missense probably damaging 1.00
R1443:Rasgrf2 UTSW 13 91983676 missense probably damaging 1.00
R1522:Rasgrf2 UTSW 13 91896086 missense probably benign 0.00
R1553:Rasgrf2 UTSW 13 91890664 missense probably damaging 1.00
R1613:Rasgrf2 UTSW 13 91902621 missense probably damaging 1.00
R1883:Rasgrf2 UTSW 13 91969030 missense probably benign
R1934:Rasgrf2 UTSW 13 91983706 splice site probably null
R1990:Rasgrf2 UTSW 13 92035965 missense probably damaging 1.00
R2037:Rasgrf2 UTSW 13 91902629 missense probably damaging 0.99
R2043:Rasgrf2 UTSW 13 92030843 missense possibly damaging 0.91
R2135:Rasgrf2 UTSW 13 91972255 missense probably benign
R2193:Rasgrf2 UTSW 13 92023713 splice site probably null
R2406:Rasgrf2 UTSW 13 91972240 missense probably benign
R3055:Rasgrf2 UTSW 13 92029075 missense probably damaging 1.00
R3916:Rasgrf2 UTSW 13 92030788 missense probably damaging 1.00
R3954:Rasgrf2 UTSW 13 91982855 missense probably damaging 0.98
R3955:Rasgrf2 UTSW 13 91982855 missense probably damaging 0.98
R3956:Rasgrf2 UTSW 13 91982855 missense probably damaging 0.98
R4133:Rasgrf2 UTSW 13 91982654 missense possibly damaging 0.59
R4177:Rasgrf2 UTSW 13 91890598 missense probably damaging 1.00
R4178:Rasgrf2 UTSW 13 91890598 missense probably damaging 1.00
R4357:Rasgrf2 UTSW 13 91890677 missense probably damaging 1.00
R4358:Rasgrf2 UTSW 13 91890677 missense probably damaging 1.00
R4359:Rasgrf2 UTSW 13 91890677 missense probably damaging 1.00
R4439:Rasgrf2 UTSW 13 91983678 missense possibly damaging 0.95
R4440:Rasgrf2 UTSW 13 91983678 missense possibly damaging 0.95
R4441:Rasgrf2 UTSW 13 91983678 missense possibly damaging 0.95
R4576:Rasgrf2 UTSW 13 91896410 missense possibly damaging 0.58
R4590:Rasgrf2 UTSW 13 92038281 missense probably damaging 1.00
R4718:Rasgrf2 UTSW 13 91990830 critical splice donor site probably null
R4778:Rasgrf2 UTSW 13 91983661 missense probably damaging 0.99
R4790:Rasgrf2 UTSW 13 91988016 missense probably damaging 1.00
R4808:Rasgrf2 UTSW 13 92023682 missense probably damaging 1.00
R5151:Rasgrf2 UTSW 13 91896036 missense probably damaging 1.00
R5286:Rasgrf2 UTSW 13 92131433 missense possibly damaging 0.94
R5902:Rasgrf2 UTSW 13 91919892 missense probably damaging 1.00
R6180:Rasgrf2 UTSW 13 92029101 missense probably damaging 1.00
R6264:Rasgrf2 UTSW 13 92030785 missense probably damaging 1.00
R6369:Rasgrf2 UTSW 13 92131446 missense probably benign
R6428:Rasgrf2 UTSW 13 91987981 missense probably damaging 1.00
R6595:Rasgrf2 UTSW 13 92030853 missense probably damaging 1.00
R6619:Rasgrf2 UTSW 13 92028519 missense probably damaging 1.00
R6988:Rasgrf2 UTSW 13 91885635 missense probably benign 0.02
X0013:Rasgrf2 UTSW 13 92030855 missense probably damaging 1.00
X0026:Rasgrf2 UTSW 13 91902535 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGTCAGTTCCCAAGAAACATAC -3'
(R):5'- CCTTGGCTACTTGAAGGTAAAGG -3'

Sequencing Primer
(F):5'- TTAAAGTGGATGAGTTGACCCC -3'
(R):5'- GAAGTGATCAGGCAAGGCTCC -3'
Posted On2015-09-24