Incidental Mutation 'R4564:Rasgrf2'
ID 343257
Institutional Source Beutler Lab
Gene Symbol Rasgrf2
Ensembl Gene ENSMUSG00000021708
Gene Name RAS protein-specific guanine nucleotide-releasing factor 2
Synonyms Grf2, 6330417G04Rik
MMRRC Submission 041789-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.191) question?
Stock # R4564 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 92028519-92268164 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 92033773 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 544 (Q544*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099326]
AlphaFold P70392
Predicted Effect probably null
Transcript: ENSMUST00000099326
AA Change: Q1145*
SMART Domains Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708
AA Change: Q1145*

DomainStartEndE-ValueType
PH 23 135 1.29e-16 SMART
IQ 204 226 1.3e0 SMART
RhoGEF 247 428 2.2e-51 SMART
RasGEFN 633 775 9.35e-15 SMART
RasGEFN 786 923 6.04e-9 SMART
RasGEF 949 1186 2.97e-112 SMART
Predicted Effect probably null
Transcript: ENSMUST00000151408
AA Change: Q544*
SMART Domains Protein: ENSMUSP00000116892
Gene: ENSMUSG00000021708
AA Change: Q544*

DomainStartEndE-ValueType
RasGEFN 33 175 9.35e-15 SMART
RasGEFN 186 323 6.04e-9 SMART
RasGEF 349 586 2.97e-112 SMART
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atad3a C T 4: 155,831,766 (GRCm39) probably null Het
Bach2 T G 4: 32,563,338 (GRCm39) S602A probably damaging Het
Ccl19 G T 4: 42,756,295 (GRCm39) S12R probably damaging Het
Cfap54 T C 10: 92,675,402 (GRCm39) probably benign Het
Cndp1 T A 18: 84,640,411 (GRCm39) I265F probably damaging Het
Cnot3 G A 7: 3,656,257 (GRCm39) R181H probably damaging Het
Dicer1 T A 12: 104,671,010 (GRCm39) K1011* probably null Het
Dip2b G A 15: 100,055,139 (GRCm39) W99* probably null Het
Fpr-rs6 A T 17: 20,403,168 (GRCm39) Y64* probably null Het
Fubp1 C A 3: 151,928,573 (GRCm39) Y480* probably null Het
Gfra1 T C 19: 58,227,682 (GRCm39) probably null Het
Gm10770 T C 2: 150,020,831 (GRCm39) T229A probably benign Het
Gm826 A C 2: 160,153,913 (GRCm39) probably benign Het
Gpd2 G A 2: 57,197,095 (GRCm39) V217I possibly damaging Het
Hectd4 T C 5: 121,488,494 (GRCm39) I3595T probably benign Het
Lmln A G 16: 32,930,226 (GRCm39) E561G probably benign Het
Lrrc71 T A 3: 87,652,715 (GRCm39) probably benign Het
Man2a2 T A 7: 80,018,586 (GRCm39) Y91F probably benign Het
Map4k4 A G 1: 40,028,135 (GRCm39) T319A probably damaging Het
Mcm6 G T 1: 128,271,196 (GRCm39) H474Q probably damaging Het
Mn1 C G 5: 111,568,533 (GRCm39) N834K possibly damaging Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Niban3 T C 8: 72,057,704 (GRCm39) probably benign Het
Npas2 A G 1: 39,326,647 (GRCm39) D44G probably damaging Het
Npc1 C T 18: 12,324,789 (GRCm39) G1235R probably damaging Het
Olfml2a C T 2: 38,850,306 (GRCm39) T674I probably benign Het
Or4f58 A G 2: 111,852,112 (GRCm39) L29P possibly damaging Het
Pgap6 A G 17: 26,336,837 (GRCm39) R252G possibly damaging Het
Plxnb1 C T 9: 108,942,488 (GRCm39) A1779V probably benign Het
Ppil3 T A 1: 58,470,481 (GRCm39) D123V probably damaging Het
Prr23a3 A G 9: 98,747,190 (GRCm39) E48G probably damaging Het
Prr5l T C 2: 101,577,094 (GRCm39) E110G probably damaging Het
Ptgir A G 7: 16,640,794 (GRCm39) M29V possibly damaging Het
R3hdm1 C T 1: 128,149,396 (GRCm39) T839M probably benign Het
Riok3 C A 18: 12,281,936 (GRCm39) R302S probably damaging Het
Rnf145 A G 11: 44,439,635 (GRCm39) K144E probably benign Het
Sin3b A C 8: 73,480,209 (GRCm39) T904P probably damaging Het
Skint4 C T 4: 111,977,066 (GRCm39) T152M probably damaging Het
Slc22a2 A G 17: 12,828,943 (GRCm39) I350V probably benign Het
Slc6a11 G T 6: 114,108,323 (GRCm39) G29V probably benign Het
Speg A C 1: 75,368,478 (GRCm39) H676P probably damaging Het
St6gal2 T A 17: 55,789,648 (GRCm39) H227Q probably damaging Het
Strn3 A G 12: 51,680,404 (GRCm39) S399P probably benign Het
Tbc1d1 A G 5: 64,330,827 (GRCm39) E2G probably damaging Het
Tecpr2 T A 12: 110,921,219 (GRCm39) M1264K probably benign Het
Trpm6 T C 19: 18,809,961 (GRCm39) L1119P possibly damaging Het
Upf2 A C 2: 6,032,123 (GRCm39) T890P unknown Het
Upk1b T A 16: 38,600,469 (GRCm39) K170N probably benign Het
Vmn1r78 A T 7: 11,886,485 (GRCm39) Y32F probably damaging Het
Vps11 A G 9: 44,272,894 (GRCm39) F12S probably damaging Het
Zfp318 T A 17: 46,723,741 (GRCm39) C1915S possibly damaging Het
Zfp346 A C 13: 55,261,520 (GRCm39) R103S probably damaging Het
Other mutations in Rasgrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Rasgrf2 APN 13 92,159,425 (GRCm39) splice site probably benign
IGL01358:Rasgrf2 APN 13 92,130,749 (GRCm39) missense probably benign 0.23
IGL01666:Rasgrf2 APN 13 92,174,718 (GRCm39) missense probably damaging 1.00
IGL01930:Rasgrf2 APN 13 92,130,857 (GRCm39) missense probably damaging 0.98
IGL02230:Rasgrf2 APN 13 92,136,145 (GRCm39) missense probably damaging 1.00
IGL02630:Rasgrf2 APN 13 92,267,900 (GRCm39) missense probably damaging 1.00
IGL02690:Rasgrf2 APN 13 92,167,273 (GRCm39) missense probably damaging 1.00
IGL02943:Rasgrf2 APN 13 92,131,752 (GRCm39) missense probably damaging 1.00
IGL03067:Rasgrf2 APN 13 92,159,413 (GRCm39) missense probably damaging 0.97
IGL03342:Rasgrf2 APN 13 92,136,098 (GRCm39) missense probably damaging 1.00
IGL03405:Rasgrf2 APN 13 92,044,170 (GRCm39) missense probably damaging 1.00
R0620:Rasgrf2 UTSW 13 92,067,936 (GRCm39) splice site probably benign
R0632:Rasgrf2 UTSW 13 92,120,393 (GRCm39) missense probably benign 0.00
R0894:Rasgrf2 UTSW 13 92,130,890 (GRCm39) missense probably damaging 1.00
R1354:Rasgrf2 UTSW 13 92,165,174 (GRCm39) missense probably damaging 1.00
R1400:Rasgrf2 UTSW 13 92,035,808 (GRCm39) missense probably damaging 1.00
R1437:Rasgrf2 UTSW 13 92,167,396 (GRCm39) missense probably damaging 1.00
R1443:Rasgrf2 UTSW 13 92,131,795 (GRCm39) missense probably damaging 1.00
R1522:Rasgrf2 UTSW 13 92,044,205 (GRCm39) missense probably benign 0.00
R1553:Rasgrf2 UTSW 13 92,038,783 (GRCm39) missense probably damaging 1.00
R1613:Rasgrf2 UTSW 13 92,050,740 (GRCm39) missense probably damaging 1.00
R1883:Rasgrf2 UTSW 13 92,117,149 (GRCm39) missense probably benign
R1934:Rasgrf2 UTSW 13 92,131,825 (GRCm39) splice site probably null
R1990:Rasgrf2 UTSW 13 92,172,473 (GRCm39) missense probably damaging 1.00
R2037:Rasgrf2 UTSW 13 92,050,748 (GRCm39) missense probably damaging 0.99
R2043:Rasgrf2 UTSW 13 92,167,351 (GRCm39) missense possibly damaging 0.91
R2135:Rasgrf2 UTSW 13 92,120,374 (GRCm39) missense probably benign
R2193:Rasgrf2 UTSW 13 92,160,221 (GRCm39) splice site probably null
R2406:Rasgrf2 UTSW 13 92,120,359 (GRCm39) missense probably benign
R3055:Rasgrf2 UTSW 13 92,165,583 (GRCm39) missense probably damaging 1.00
R3916:Rasgrf2 UTSW 13 92,167,296 (GRCm39) missense probably damaging 1.00
R3954:Rasgrf2 UTSW 13 92,130,974 (GRCm39) missense probably damaging 0.98
R3955:Rasgrf2 UTSW 13 92,130,974 (GRCm39) missense probably damaging 0.98
R3956:Rasgrf2 UTSW 13 92,130,974 (GRCm39) missense probably damaging 0.98
R4133:Rasgrf2 UTSW 13 92,130,773 (GRCm39) missense possibly damaging 0.59
R4177:Rasgrf2 UTSW 13 92,038,717 (GRCm39) missense probably damaging 1.00
R4178:Rasgrf2 UTSW 13 92,038,717 (GRCm39) missense probably damaging 1.00
R4357:Rasgrf2 UTSW 13 92,038,796 (GRCm39) missense probably damaging 1.00
R4358:Rasgrf2 UTSW 13 92,038,796 (GRCm39) missense probably damaging 1.00
R4359:Rasgrf2 UTSW 13 92,038,796 (GRCm39) missense probably damaging 1.00
R4439:Rasgrf2 UTSW 13 92,131,797 (GRCm39) missense possibly damaging 0.95
R4440:Rasgrf2 UTSW 13 92,131,797 (GRCm39) missense possibly damaging 0.95
R4441:Rasgrf2 UTSW 13 92,131,797 (GRCm39) missense possibly damaging 0.95
R4576:Rasgrf2 UTSW 13 92,044,529 (GRCm39) missense possibly damaging 0.58
R4590:Rasgrf2 UTSW 13 92,174,789 (GRCm39) missense probably damaging 1.00
R4718:Rasgrf2 UTSW 13 92,138,716 (GRCm39) critical splice donor site probably null
R4778:Rasgrf2 UTSW 13 92,131,780 (GRCm39) missense probably damaging 0.99
R4790:Rasgrf2 UTSW 13 92,136,135 (GRCm39) missense probably damaging 1.00
R4808:Rasgrf2 UTSW 13 92,160,190 (GRCm39) missense probably damaging 1.00
R5151:Rasgrf2 UTSW 13 92,044,155 (GRCm39) missense probably damaging 1.00
R5286:Rasgrf2 UTSW 13 92,267,941 (GRCm39) missense possibly damaging 0.94
R5902:Rasgrf2 UTSW 13 92,068,011 (GRCm39) missense probably damaging 1.00
R6180:Rasgrf2 UTSW 13 92,165,609 (GRCm39) missense probably damaging 1.00
R6264:Rasgrf2 UTSW 13 92,167,293 (GRCm39) missense probably damaging 1.00
R6369:Rasgrf2 UTSW 13 92,267,954 (GRCm39) missense probably benign
R6428:Rasgrf2 UTSW 13 92,136,100 (GRCm39) missense probably damaging 1.00
R6595:Rasgrf2 UTSW 13 92,167,361 (GRCm39) missense probably damaging 1.00
R6619:Rasgrf2 UTSW 13 92,165,027 (GRCm39) missense probably damaging 1.00
R6988:Rasgrf2 UTSW 13 92,033,754 (GRCm39) missense probably benign 0.02
R7026:Rasgrf2 UTSW 13 92,131,732 (GRCm39) missense probably damaging 1.00
R7038:Rasgrf2 UTSW 13 92,130,952 (GRCm39) missense possibly damaging 0.95
R7045:Rasgrf2 UTSW 13 92,159,100 (GRCm39) intron probably benign
R7056:Rasgrf2 UTSW 13 92,167,203 (GRCm39) missense probably damaging 0.99
R7058:Rasgrf2 UTSW 13 92,034,521 (GRCm39) missense probably damaging 0.99
R7256:Rasgrf2 UTSW 13 92,032,637 (GRCm39) nonsense probably null
R7392:Rasgrf2 UTSW 13 92,041,856 (GRCm39) missense
R7469:Rasgrf2 UTSW 13 92,165,530 (GRCm39) critical splice donor site probably null
R7618:Rasgrf2 UTSW 13 92,136,085 (GRCm39) missense
R7641:Rasgrf2 UTSW 13 92,267,914 (GRCm39) missense possibly damaging 0.65
R7674:Rasgrf2 UTSW 13 92,267,914 (GRCm39) missense possibly damaging 0.65
R7784:Rasgrf2 UTSW 13 92,044,201 (GRCm39) missense
R7962:Rasgrf2 UTSW 13 92,167,300 (GRCm39) missense probably damaging 0.99
R8056:Rasgrf2 UTSW 13 92,167,321 (GRCm39) missense probably damaging 0.97
R8218:Rasgrf2 UTSW 13 92,130,796 (GRCm39) missense
R8796:Rasgrf2 UTSW 13 92,038,685 (GRCm39) missense
R8913:Rasgrf2 UTSW 13 92,159,034 (GRCm39) missense probably benign 0.05
R8971:Rasgrf2 UTSW 13 92,158,225 (GRCm39) missense possibly damaging 0.80
R9020:Rasgrf2 UTSW 13 92,165,146 (GRCm39) missense possibly damaging 0.93
R9487:Rasgrf2 UTSW 13 92,267,759 (GRCm39) missense probably benign
R9562:Rasgrf2 UTSW 13 92,034,469 (GRCm39) critical splice donor site probably null
R9712:Rasgrf2 UTSW 13 92,136,092 (GRCm39) missense
R9766:Rasgrf2 UTSW 13 92,160,188 (GRCm39) missense probably damaging 1.00
R9800:Rasgrf2 UTSW 13 92,267,860 (GRCm39) missense probably damaging 0.99
X0013:Rasgrf2 UTSW 13 92,167,363 (GRCm39) missense probably damaging 1.00
X0026:Rasgrf2 UTSW 13 92,050,654 (GRCm39) missense probably damaging 0.99
Z1177:Rasgrf2 UTSW 13 92,159,081 (GRCm39) missense unknown
Z1177:Rasgrf2 UTSW 13 92,131,632 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- GGGTCAGTTCCCAAGAAACATAC -3'
(R):5'- CCTTGGCTACTTGAAGGTAAAGG -3'

Sequencing Primer
(F):5'- TTAAAGTGGATGAGTTGACCCC -3'
(R):5'- GAAGTGATCAGGCAAGGCTCC -3'
Posted On 2015-09-24