Incidental Mutation 'R4287:Ndufb8'
ID322081
Institutional Source Beutler Lab
Gene Symbol Ndufb8
Ensembl Gene ENSMUSG00000025204
Gene NameNADH dehydrogenase (ubiquinone) 1 beta subcomplex 8
Synonyms
MMRRC Submission 041652-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4287 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location44548572-44555440 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44552691 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 107 (I107V)
Ref Sequence ENSEMBL: ENSMUSP00000132421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026222] [ENSMUST00000167027] [ENSMUST00000168083] [ENSMUST00000169304] [ENSMUST00000171415]
Predicted Effect probably benign
Transcript: ENSMUST00000026222
SMART Domains Protein: ENSMUSP00000026222
Gene: ENSMUSG00000025204

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
Pfam:NDUF_B8 15 186 1.1e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166557
Predicted Effect probably benign
Transcript: ENSMUST00000166808
SMART Domains Protein: ENSMUSP00000126763
Gene: ENSMUSG00000091471

DomainStartEndE-ValueType
Pfam:NDUF_B8 1 71 1.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167027
SMART Domains Protein: ENSMUSP00000130918
Gene: ENSMUSG00000025204

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
Pfam:NDUF_B8 54 139 2.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168083
SMART Domains Protein: ENSMUSP00000132740
Gene: ENSMUSG00000025204

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169181
Predicted Effect probably benign
Transcript: ENSMUST00000169304
AA Change: I107V

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000132421
Gene: ENSMUSG00000025204
AA Change: I107V

DomainStartEndE-ValueType
Pfam:NDUF_B8 1 108 4e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171415
SMART Domains Protein: ENSMUSP00000128192
Gene: ENSMUSG00000025204

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
Pfam:NDUF_B8 15 157 2.9e-67 PFAM
Meta Mutation Damage Score 0.1184 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc5 A G 5: 122,800,601 V362A probably benign Het
Ash1l T A 3: 89,066,415 C2594S probably damaging Het
Ccdc82 C A 9: 13,253,418 Q303K probably benign Het
Cog1 A G 11: 113,654,027 Y345C probably damaging Het
Fpgt T C 3: 155,091,360 probably benign Het
Glrb A T 3: 80,845,232 V408D possibly damaging Het
Gm7135 A G 1: 97,400,398 noncoding transcript Het
Il1rn T C 2: 24,349,545 L151P probably damaging Het
Itgav G T 2: 83,724,840 E36* probably null Het
Kidins220 G A 12: 25,056,846 E1433K possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra3 A G 6: 130,334,302 C39R probably benign Het
Lce1i A G 3: 92,777,435 S145P unknown Het
Memo1 T C 17: 74,255,298 probably null Het
Mpp3 G A 11: 102,023,463 A102V probably damaging Het
Mug2 T A 6: 122,063,673 D727E probably benign Het
Olfr186 A T 16: 59,027,613 M98K probably benign Het
Pnn C T 12: 59,072,170 T513I possibly damaging Het
Ric8a A G 7: 140,861,422 Y210C probably damaging Het
Ripor2 G A 13: 24,725,009 V1037M probably damaging Het
Rreb1 A T 13: 37,931,931 T1089S probably benign Het
Rrs1 C T 1: 9,546,215 S231L probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sec23ip A G 7: 128,777,333 D838G probably benign Het
Setbp1 T C 18: 78,859,061 I464V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc41a3 A T 6: 90,640,922 H310L probably benign Het
Smurf1 A G 5: 144,891,458 S363P probably benign Het
Tln1 C T 4: 43,543,509 R1269Q probably benign Het
Tmed3 A G 9: 89,704,898 S10P probably benign Het
Tomm70a T G 16: 57,140,622 Y313D probably damaging Het
Umodl1 A G 17: 30,988,065 E810G probably benign Het
Unc5c T C 3: 141,714,674 I52T probably damaging Het
Unc5d T A 8: 28,719,796 Y432F probably benign Het
Vmn2r97 A T 17: 18,948,075 probably benign Het
Zfp629 T C 7: 127,611,938 Y233C probably damaging Het
Zfp986 T C 4: 145,892,518 probably null Het
Other mutations in Ndufb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0463:Ndufb8 UTSW 19 44550345 missense possibly damaging 0.82
R0608:Ndufb8 UTSW 19 44550345 missense possibly damaging 0.82
R1637:Ndufb8 UTSW 19 44555035 missense probably benign 0.20
R1663:Ndufb8 UTSW 19 44550381 missense probably damaging 1.00
R2099:Ndufb8 UTSW 19 44555310 splice site probably benign
R6088:Ndufb8 UTSW 19 44555025 missense probably benign 0.00
R6494:Ndufb8 UTSW 19 44555305 missense probably null
R7376:Ndufb8 UTSW 19 44555355 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGGTTATCTGGTCCATGCAG -3'
(R):5'- CCTGTCTTTTGCAAGGACAGTTTG -3'

Sequencing Primer
(F):5'- GGTCAGGCCTTTCATCTTT -3'
(R):5'- CAAGGACAGTTTGTGACAGTTATG -3'
Posted On2015-06-20