Incidental Mutation 'R4287:Klra3'
ID368372
Institutional Source Beutler Lab
Gene Symbol Klra3
Ensembl Gene ENSMUSG00000067591
Gene Namekiller cell lectin-like receptor, subfamily A, member 3
SynonymsNK-2.1, Nk2.1, Ly49C, Nk-2, Nk2, Ly49c, 5E6
MMRRC Submission 041652-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R4287 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location130323289-130337574 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130334302 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 39 (C39R)
Ref Sequence ENSEMBL: ENSMUSP00000107629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088017] [ENSMUST00000111998]
Predicted Effect probably benign
Transcript: ENSMUST00000088017
AA Change: C39R

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000085333
Gene: ENSMUSG00000067591
AA Change: C39R

DomainStartEndE-ValueType
low complexity region 56 66 N/A INTRINSIC
Blast:CLECT 73 117 1e-7 BLAST
CLECT 143 258 7.11e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111998
AA Change: C39R

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000107629
Gene: ENSMUSG00000067591
AA Change: C39R

DomainStartEndE-ValueType
low complexity region 56 66 N/A INTRINSIC
Blast:CLECT 73 117 1e-7 BLAST
CLECT 143 258 7.11e-16 SMART
Meta Mutation Damage Score 0.1456 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc5 A G 5: 122,800,601 V362A probably benign Het
Ash1l T A 3: 89,066,415 C2594S probably damaging Het
Ccdc82 C A 9: 13,253,418 Q303K probably benign Het
Cog1 A G 11: 113,654,027 Y345C probably damaging Het
Fpgt T C 3: 155,091,360 probably benign Het
Glrb A T 3: 80,845,232 V408D possibly damaging Het
Gm7135 A G 1: 97,400,398 noncoding transcript Het
Il1rn T C 2: 24,349,545 L151P probably damaging Het
Itgav G T 2: 83,724,840 E36* probably null Het
Kidins220 G A 12: 25,056,846 E1433K possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lce1i A G 3: 92,777,435 S145P unknown Het
Memo1 T C 17: 74,255,298 probably null Het
Mpp3 G A 11: 102,023,463 A102V probably damaging Het
Mug2 T A 6: 122,063,673 D727E probably benign Het
Ndufb8 T C 19: 44,552,691 I107V probably benign Het
Olfr186 A T 16: 59,027,613 M98K probably benign Het
Pnn C T 12: 59,072,170 T513I possibly damaging Het
Ric8a A G 7: 140,861,422 Y210C probably damaging Het
Ripor2 G A 13: 24,725,009 V1037M probably damaging Het
Rreb1 A T 13: 37,931,931 T1089S probably benign Het
Rrs1 C T 1: 9,546,215 S231L probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sec23ip A G 7: 128,777,333 D838G probably benign Het
Setbp1 T C 18: 78,859,061 I464V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc41a3 A T 6: 90,640,922 H310L probably benign Het
Smurf1 A G 5: 144,891,458 S363P probably benign Het
Tln1 C T 4: 43,543,509 R1269Q probably benign Het
Tmed3 A G 9: 89,704,898 S10P probably benign Het
Tomm70a T G 16: 57,140,622 Y313D probably damaging Het
Umodl1 A G 17: 30,988,065 E810G probably benign Het
Unc5c T C 3: 141,714,674 I52T probably damaging Het
Unc5d T A 8: 28,719,796 Y432F probably benign Het
Vmn2r97 A T 17: 18,948,075 probably benign Het
Zfp629 T C 7: 127,611,938 Y233C probably damaging Het
Zfp986 T C 4: 145,892,518 probably null Het
Other mutations in Klra3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Klra3 APN 6 130327144 missense probably benign 0.26
R0004:Klra3 UTSW 6 130323687 missense probably damaging 1.00
R1532:Klra3 UTSW 6 130333144 missense probably benign 0.12
R1533:Klra3 UTSW 6 130333144 missense probably benign 0.12
R1534:Klra3 UTSW 6 130333144 missense probably benign 0.12
R1536:Klra3 UTSW 6 130333144 missense probably benign 0.12
R1547:Klra3 UTSW 6 130333144 missense probably benign 0.12
R1548:Klra3 UTSW 6 130333144 missense probably benign 0.12
R1566:Klra3 UTSW 6 130333144 missense probably benign 0.12
R1567:Klra3 UTSW 6 130333144 missense probably benign 0.12
R1769:Klra3 UTSW 6 130330263 critical splice acceptor site probably null
R1772:Klra3 UTSW 6 130323708 missense probably benign
R1806:Klra3 UTSW 6 130327070 missense probably damaging 0.99
R2131:Klra3 UTSW 6 130335775 missense probably benign 0.07
R2138:Klra3 UTSW 6 130333158 missense probably benign 0.00
R2152:Klra3 UTSW 6 130333144 missense probably benign 0.12
R2154:Klra3 UTSW 6 130333144 missense probably benign 0.12
R2906:Klra3 UTSW 6 130333339 missense probably damaging 0.99
R2907:Klra3 UTSW 6 130333339 missense probably damaging 0.99
R4732:Klra3 UTSW 6 130327132 missense possibly damaging 0.94
R4733:Klra3 UTSW 6 130327132 missense possibly damaging 0.94
R4829:Klra3 UTSW 6 130323616 missense probably benign 0.05
R5308:Klra3 UTSW 6 130334307 splice site probably null
R6701:Klra3 UTSW 6 130330253 missense probably benign 0.01
R7019:Klra3 UTSW 6 130327124 missense probably damaging 1.00
R7174:Klra3 UTSW 6 130335978 intron probably null
X0052:Klra3 UTSW 6 130333180 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAGAACCATGGACAGTGTG -3'
(R):5'- GGATTCACAATACAAGGTCAAGC -3'

Sequencing Primer
(F):5'- CCATGGACAGTGTGTATAACTGC -3'
(R):5'- GTGGAAATTCAGACACATAGGATTTC -3'
Posted On2016-02-02