Incidental Mutation 'R4533:Crtc3'
ID333199
Institutional Source Beutler Lab
Gene Symbol Crtc3
Ensembl Gene ENSMUSG00000030527
Gene NameCREB regulated transcription coactivator 3
Synonyms
MMRRC Submission 041773-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R4533 (G1)
Quality Score197
Status Validated
Chromosome7
Chromosomal Location80586627-80688877 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80589795 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 603 (M603K)
Ref Sequence ENSEMBL: ENSMUSP00000113540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122255]
Predicted Effect probably damaging
Transcript: ENSMUST00000122255
AA Change: M603K

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113540
Gene: ENSMUSG00000030527
AA Change: M603K

DomainStartEndE-ValueType
Pfam:TORC_N 11 82 1.2e-20 PFAM
Pfam:TORC_M 159 321 1.9e-64 PFAM
low complexity region 366 380 N/A INTRINSIC
low complexity region 438 480 N/A INTRINSIC
Pfam:TORC_C 545 619 2.2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149176
Meta Mutation Damage Score 0.396 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the CREB regulated transcription coactivator gene family. This family regulates CREB-dependent gene transcription in a phosphorylation-independent manner and may be selective for cAMP-responsive genes. The protein encoded by this gene may induce mitochondrial biogenesis and attenuate catecholamine signaling in adipose tissue. A translocation event between this gene and Notch coactivator mastermind-like gene 2, which results in a fusion protein, has been reported in mucoepidermoid carcinomas. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null mutation display resistance to diet-induced obesity, increased energy expenditure, decreased white adipose tissue mass, increased brown adipose cell numbers, and increased core temperature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 A G 9: 90,180,708 Y405C probably damaging Het
Ago3 A T 4: 126,345,563 S832T probably damaging Het
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Anapc5 T C 5: 122,791,735 E561G possibly damaging Het
Art5 T C 7: 102,098,338 H78R probably benign Het
Blvra T A 2: 127,090,384 probably null Het
Ccdc171 A G 4: 83,657,342 T488A possibly damaging Het
Csmd1 T C 8: 15,931,037 probably null Het
Dbh C A 2: 27,177,331 H409Q possibly damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Gm12185 T C 11: 48,907,920 Y582C probably damaging Het
Gm12185 T C 11: 48,908,094 N524S possibly damaging Het
Gm7356 A C 17: 14,001,410 I119R probably damaging Het
Heatr1 T A 13: 12,434,511 D1963E probably benign Het
Ighv1-37 A T 12: 114,896,527 V21D probably damaging Het
Itga3 T G 11: 95,057,293 Q602P probably benign Het
Kcmf1 G A 6: 72,849,591 R152C probably damaging Het
Lin54 T C 5: 100,485,403 I141V possibly damaging Het
Mast1 T A 8: 84,921,361 H497L probably damaging Het
Mrpl44 T C 1: 79,776,254 F41S possibly damaging Het
Myo18b T C 5: 112,693,025 R2301G probably damaging Het
Nek1 A T 8: 61,007,213 M58L possibly damaging Het
Olfr726 T C 14: 50,083,699 probably null Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
P3h3 A G 6: 124,854,408 V338A possibly damaging Het
Pcdha7 T C 18: 36,975,407 V495A possibly damaging Het
Plcb3 T C 19: 6,956,272 E895G probably benign Het
Plekha5 A G 6: 140,570,331 E770G probably damaging Het
Ptchd3 C T 11: 121,836,431 S377F probably damaging Het
Ptprj C T 2: 90,439,955 D1266N probably damaging Het
Raly A T 2: 154,865,933 E291V probably damaging Het
Rnf217 C A 10: 31,608,763 C141F possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc12a3 A G 8: 94,357,086 M914V probably null Het
Tbc1d9 A G 8: 83,270,918 T1035A probably damaging Het
Tex14 C T 11: 87,536,829 R36* probably null Het
Tiparp A G 3: 65,546,347 D172G probably benign Het
Ttc3 T A 16: 94,466,877 probably benign Het
Uap1 A T 1: 170,143,425 I466N probably damaging Het
Ubr1 T C 2: 120,942,482 T426A possibly damaging Het
Vmn1r77 T A 7: 12,041,829 H177Q probably benign Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Vwc2l G A 1: 70,882,139 C151Y probably damaging Het
Wdr12 T C 1: 60,078,195 Y414C probably benign Het
Zfp609 A C 9: 65,703,608 V691G probably benign Het
Zmiz1 T C 14: 25,645,660 Y254H probably damaging Het
Other mutations in Crtc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Crtc3 APN 7 80598739 intron probably benign
IGL01325:Crtc3 APN 7 80677368 missense probably damaging 0.96
IGL01802:Crtc3 APN 7 80604368 nonsense probably null
IGL02166:Crtc3 APN 7 80677399 missense probably damaging 1.00
IGL02601:Crtc3 APN 7 80592567 missense probably damaging 1.00
IGL02719:Crtc3 APN 7 80618658 critical splice acceptor site probably null
IGL02936:Crtc3 APN 7 80589763 missense probably damaging 1.00
IGL03075:Crtc3 APN 7 80604403 intron probably benign
R0856:Crtc3 UTSW 7 80595624 missense probably damaging 0.99
R1655:Crtc3 UTSW 7 80598776 missense possibly damaging 0.67
R1962:Crtc3 UTSW 7 80589931 missense probably damaging 1.00
R4484:Crtc3 UTSW 7 80589948 missense probably damaging 1.00
R4818:Crtc3 UTSW 7 80677422 missense possibly damaging 0.65
R5292:Crtc3 UTSW 7 80618610 missense possibly damaging 0.94
R5908:Crtc3 UTSW 7 80595794 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- TGCTGTAACCACCGTCAAG -3'
(R):5'- TTTAAAAGCCTTGGTCCTCCTG -3'

Sequencing Primer
(F):5'- CCGTCAAGGTGTTTGCTGGC -3'
(R):5'- GGTCCTCCTGTCTCCAAATTTC -3'
Posted On2015-08-18