Incidental Mutation 'R4533:Plcb3'
ID333221
Institutional Source Beutler Lab
Gene Symbol Plcb3
Ensembl Gene ENSMUSG00000024960
Gene Namephospholipase C, beta 3
Synonyms
MMRRC Submission 041773-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.300) question?
Stock #R4533 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6953714-6969759 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6956272 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 895 (E895G)
Ref Sequence ENSEMBL: ENSMUSP00000025912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025910] [ENSMUST00000025912] [ENSMUST00000113423] [ENSMUST00000113426]
Predicted Effect probably benign
Transcript: ENSMUST00000025910
SMART Domains Protein: ENSMUSP00000025910
Gene: ENSMUSG00000024959

DomainStartEndE-ValueType
Pfam:Bcl-2_BAD 43 204 5e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025912
AA Change: E895G

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000025912
Gene: ENSMUSG00000024960
AA Change: E895G

DomainStartEndE-ValueType
Pfam:EF-hand_like 225 316 6.6e-23 PFAM
PLCXc 317 468 4.26e-73 SMART
low complexity region 488 515 N/A INTRINSIC
low complexity region 553 578 N/A INTRINSIC
PLCYc 591 707 3.88e-76 SMART
C2 728 826 4.52e-14 SMART
low complexity region 917 936 N/A INTRINSIC
Pfam:PLC-beta_C 1029 1202 5.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113423
SMART Domains Protein: ENSMUSP00000109050
Gene: ENSMUSG00000024959

DomainStartEndE-ValueType
Pfam:Bcl-2_BAD 1 162 9.1e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113426
SMART Domains Protein: ENSMUSP00000109053
Gene: ENSMUSG00000024959

DomainStartEndE-ValueType
Pfam:Bcl-2_BAD 43 172 5.7e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145463
SMART Domains Protein: ENSMUSP00000121778
Gene: ENSMUSG00000024959

DomainStartEndE-ValueType
Pfam:Bcl-2_BAD 1 51 1.4e-11 PFAM
Meta Mutation Damage Score 0.0932 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphoinositide phospholipase C beta enzyme family that catalyze the production of the secondary messengers diacylglycerol and inositol 1,4,5-triphosphate from phosphatidylinositol in G-protein-linked receptor-mediated signal transduction. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for one targeted mutation die at E2.5 and exhibit poor embryonic organization and hypocellularity. Mice homozygous for a second targeted mutation survive to adulthood and exhibit an increased antinocieptive response to opioids. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 A G 9: 90,180,708 Y405C probably damaging Het
Ago3 A T 4: 126,345,563 S832T probably damaging Het
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Anapc5 T C 5: 122,791,735 E561G possibly damaging Het
Art5 T C 7: 102,098,338 H78R probably benign Het
Blvra T A 2: 127,090,384 probably null Het
Ccdc171 A G 4: 83,657,342 T488A possibly damaging Het
Crtc3 A T 7: 80,589,795 M603K probably damaging Het
Csmd1 T C 8: 15,931,037 probably null Het
Dbh C A 2: 27,177,331 H409Q possibly damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Gm12185 T C 11: 48,907,920 Y582C probably damaging Het
Gm12185 T C 11: 48,908,094 N524S possibly damaging Het
Gm7356 A C 17: 14,001,410 I119R probably damaging Het
Heatr1 T A 13: 12,434,511 D1963E probably benign Het
Ighv1-37 A T 12: 114,896,527 V21D probably damaging Het
Itga3 T G 11: 95,057,293 Q602P probably benign Het
Kcmf1 G A 6: 72,849,591 R152C probably damaging Het
Lin54 T C 5: 100,485,403 I141V possibly damaging Het
Mast1 T A 8: 84,921,361 H497L probably damaging Het
Mrpl44 T C 1: 79,776,254 F41S possibly damaging Het
Myo18b T C 5: 112,693,025 R2301G probably damaging Het
Nek1 A T 8: 61,007,213 M58L possibly damaging Het
Olfr726 T C 14: 50,083,699 probably null Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
P3h3 A G 6: 124,854,408 V338A possibly damaging Het
Pcdha7 T C 18: 36,975,407 V495A possibly damaging Het
Plekha5 A G 6: 140,570,331 E770G probably damaging Het
Ptchd3 C T 11: 121,836,431 S377F probably damaging Het
Ptprj C T 2: 90,439,955 D1266N probably damaging Het
Raly A T 2: 154,865,933 E291V probably damaging Het
Rnf217 C A 10: 31,608,763 C141F possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc12a3 A G 8: 94,357,086 M914V probably null Het
Tbc1d9 A G 8: 83,270,918 T1035A probably damaging Het
Tex14 C T 11: 87,536,829 R36* probably null Het
Tiparp A G 3: 65,546,347 D172G probably benign Het
Ttc3 T A 16: 94,466,877 probably benign Het
Uap1 A T 1: 170,143,425 I466N probably damaging Het
Ubr1 T C 2: 120,942,482 T426A possibly damaging Het
Vmn1r77 T A 7: 12,041,829 H177Q probably benign Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Vwc2l G A 1: 70,882,139 C151Y probably damaging Het
Wdr12 T C 1: 60,078,195 Y414C probably benign Het
Zfp609 A C 9: 65,703,608 V691G probably benign Het
Zmiz1 T C 14: 25,645,660 Y254H probably damaging Het
Other mutations in Plcb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Plcb3 APN 19 6955322 missense probably benign 0.27
IGL01370:Plcb3 APN 19 6962824 missense probably damaging 0.99
IGL01385:Plcb3 APN 19 6957908 missense probably benign
IGL01511:Plcb3 APN 19 6955843 missense probably damaging 0.99
IGL02182:Plcb3 APN 19 6969620 missense probably benign 0.22
IGL02240:Plcb3 APN 19 6958080 splice site probably benign
IGL02350:Plcb3 APN 19 6958178 missense probably damaging 1.00
IGL02357:Plcb3 APN 19 6958178 missense probably damaging 1.00
IGL02550:Plcb3 APN 19 6960176 nonsense probably null
IGL02866:Plcb3 APN 19 6957676 missense probably damaging 1.00
IGL03180:Plcb3 APN 19 6956153 missense probably benign 0.44
IGL03327:Plcb3 APN 19 6955052 missense probably benign
IGL03346:Plcb3 APN 19 6955052 missense probably benign
Multifarious UTSW 19 6954703 critical splice donor site probably null
R0042:Plcb3 UTSW 19 6966420 missense probably damaging 1.00
R0125:Plcb3 UTSW 19 6958908 missense probably damaging 1.00
R0240:Plcb3 UTSW 19 6962995 missense probably benign 0.16
R0240:Plcb3 UTSW 19 6962995 missense probably benign 0.16
R0724:Plcb3 UTSW 19 6963392 missense probably damaging 1.00
R0781:Plcb3 UTSW 19 6961913 nonsense probably null
R0945:Plcb3 UTSW 19 6954878 missense probably damaging 1.00
R1110:Plcb3 UTSW 19 6961913 nonsense probably null
R1414:Plcb3 UTSW 19 6963017 missense probably damaging 1.00
R1454:Plcb3 UTSW 19 6955046 missense possibly damaging 0.64
R1533:Plcb3 UTSW 19 6957673 missense possibly damaging 0.70
R1652:Plcb3 UTSW 19 6955296 missense probably benign 0.00
R1795:Plcb3 UTSW 19 6956013 unclassified probably benign
R1870:Plcb3 UTSW 19 6962985 missense probably benign 0.04
R1934:Plcb3 UTSW 19 6964609 missense probably damaging 1.00
R3980:Plcb3 UTSW 19 6966435 missense probably damaging 1.00
R4397:Plcb3 UTSW 19 6965825 missense probably damaging 0.96
R4576:Plcb3 UTSW 19 6959047 splice site probably benign
R4815:Plcb3 UTSW 19 6962984 missense possibly damaging 0.59
R4903:Plcb3 UTSW 19 6955843 missense probably damaging 0.99
R5093:Plcb3 UTSW 19 6966210 missense probably damaging 1.00
R5555:Plcb3 UTSW 19 6966219 missense probably benign 0.19
R5593:Plcb3 UTSW 19 6954749 missense possibly damaging 0.94
R5626:Plcb3 UTSW 19 6955275 missense probably benign 0.24
R5661:Plcb3 UTSW 19 6963220 missense probably damaging 1.00
R5713:Plcb3 UTSW 19 6957692 missense probably damaging 0.99
R5741:Plcb3 UTSW 19 6954422 nonsense probably null
R6025:Plcb3 UTSW 19 6956179 missense probably benign 0.03
R6063:Plcb3 UTSW 19 6962834 missense possibly damaging 0.69
R6155:Plcb3 UTSW 19 6966165 missense probably damaging 1.00
R6157:Plcb3 UTSW 19 6966165 missense probably damaging 1.00
R6178:Plcb3 UTSW 19 6954703 critical splice donor site probably null
R7085:Plcb3 UTSW 19 6960133 missense possibly damaging 0.80
R7117:Plcb3 UTSW 19 6964378 missense probably damaging 1.00
R7134:Plcb3 UTSW 19 6965330 missense probably damaging 1.00
R7153:Plcb3 UTSW 19 6958084 critical splice donor site probably null
R7316:Plcb3 UTSW 19 6966385 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAATCATCTCGCTGCCCTG -3'
(R):5'- AACTCAGAGCCTTCCTGATGG -3'

Sequencing Primer
(F):5'- AAGCTGTGGGATCCAGCTG -3'
(R):5'- CCTGATGGCTTGGGCAAG -3'
Posted On2015-08-18