Incidental Mutation 'R4600:Mbd5'
ID345487
Institutional Source Beutler Lab
Gene Symbol Mbd5
Ensembl Gene ENSMUSG00000036792
Gene Namemethyl-CpG binding domain protein 5
SynonymsC030040A15Rik, OTTMUSG00000012483, 9430004D19Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4600 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location48949508-49325405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 49257197 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 473 (M473R)
Ref Sequence ENSEMBL: ENSMUSP00000108365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047413] [ENSMUST00000112745] [ENSMUST00000112754]
Predicted Effect probably benign
Transcript: ENSMUST00000047413
AA Change: M473R

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000036847
Gene: ENSMUSG00000036792
AA Change: M473R

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Blast:MBD 24 77 9e-11 BLAST
low complexity region 332 342 N/A INTRINSIC
low complexity region 429 443 N/A INTRINSIC
low complexity region 459 467 N/A INTRINSIC
low complexity region 499 512 N/A INTRINSIC
low complexity region 535 546 N/A INTRINSIC
low complexity region 571 613 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
low complexity region 912 932 N/A INTRINSIC
low complexity region 934 948 N/A INTRINSIC
low complexity region 992 1010 N/A INTRINSIC
low complexity region 1020 1035 N/A INTRINSIC
low complexity region 1112 1136 N/A INTRINSIC
low complexity region 1173 1184 N/A INTRINSIC
low complexity region 1206 1229 N/A INTRINSIC
low complexity region 1552 1562 N/A INTRINSIC
SCOP:d1khca_ 1615 1718 2e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112745
AA Change: M473R

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108365
Gene: ENSMUSG00000036792
AA Change: M473R

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Blast:MBD 24 77 4e-11 BLAST
low complexity region 332 342 N/A INTRINSIC
low complexity region 429 443 N/A INTRINSIC
low complexity region 459 467 N/A INTRINSIC
low complexity region 499 512 N/A INTRINSIC
low complexity region 535 546 N/A INTRINSIC
low complexity region 571 613 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112754
AA Change: M473R

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000108374
Gene: ENSMUSG00000036792
AA Change: M473R

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Blast:MBD 24 77 8e-11 BLAST
low complexity region 332 342 N/A INTRINSIC
low complexity region 429 443 N/A INTRINSIC
low complexity region 459 467 N/A INTRINSIC
low complexity region 499 512 N/A INTRINSIC
low complexity region 535 546 N/A INTRINSIC
low complexity region 571 613 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
low complexity region 912 932 N/A INTRINSIC
low complexity region 934 948 N/A INTRINSIC
low complexity region 976 999 N/A INTRINSIC
low complexity region 1322 1332 N/A INTRINSIC
SCOP:d1khca_ 1385 1488 4e-17 SMART
Predicted Effect unknown
Transcript: ENSMUST00000122841
AA Change: M212R
SMART Domains Protein: ENSMUSP00000119317
Gene: ENSMUSG00000036792
AA Change: M212R

DomainStartEndE-ValueType
low complexity region 72 82 N/A INTRINSIC
low complexity region 169 183 N/A INTRINSIC
low complexity region 199 207 N/A INTRINSIC
low complexity region 239 252 N/A INTRINSIC
low complexity region 275 286 N/A INTRINSIC
low complexity region 311 353 N/A INTRINSIC
low complexity region 439 459 N/A INTRINSIC
low complexity region 581 592 N/A INTRINSIC
low complexity region 652 672 N/A INTRINSIC
low complexity region 674 688 N/A INTRINSIC
low complexity region 732 750 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 852 876 N/A INTRINSIC
low complexity region 913 924 N/A INTRINSIC
low complexity region 946 969 N/A INTRINSIC
low complexity region 1011 1022 N/A INTRINSIC
low complexity region 1056 1064 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199257
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the methyl-CpG-binding domain (MBD) family. The MBD consists of about 70 residues and is the minimal region required for a methyl-CpG-binding protein binding specifically to methylated DNA. In addition to the MBD domain, this protein contains a PWWP domain (Pro-Trp-Trp-Pro motif), which consists of 100-150 amino acids and is found in numerous proteins that are involved in cell division, growth and differentiation. Mutations in this gene cause mental retardation autosomal dominant type 1. Haploinsufficiency of this gene is associated with a syndrome involving microcephaly, intellectual disabilities, severe speech impairment, and seizures. Alternatively spliced transcript variants have been found, but their full-length nature is not determined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozgyous for a knock-out allele exhibit severe postnatal growth retardation leading to lethality by P22, decreased body, brain and liver weights, reduced IGF-I and GH levels, and abnormal glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
2700049A03Rik T C 12: 71,148,263 F145L possibly damaging Het
Aars2 T A 17: 45,516,921 D555E probably damaging Het
Ago1 C A 4: 126,460,392 M208I probably benign Het
Ak7 G A 12: 105,713,575 V123M probably benign Het
Amfr A G 8: 93,974,221 L537P probably damaging Het
Apob A G 12: 8,008,568 D2317G probably damaging Het
Asb6 T A 2: 30,824,471 D209V probably damaging Het
AY358078 T A 14: 51,826,075 C393S possibly damaging Het
Baz2a T A 10: 128,121,183 C932S probably damaging Het
BC067074 A G 13: 113,319,249 R610G possibly damaging Het
Btnl10 A G 11: 58,923,600 I369V probably benign Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Clic4 A T 4: 135,238,989 probably null Het
Col6a3 A G 1: 90,781,904 S1857P unknown Het
Cracr2a A C 6: 127,603,888 D9A probably benign Het
Dcst1 T C 3: 89,356,336 E384G probably benign Het
Ddx4 T C 13: 112,612,060 K435E probably damaging Het
Deaf1 T A 7: 141,310,971 T433S possibly damaging Het
Dnah3 T A 7: 120,089,946 M82L probably benign Het
Dnhd1 G T 7: 105,703,644 R2668L probably damaging Het
Efcab6 C T 15: 83,946,925 G596D probably benign Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Fam181b C A 7: 93,080,784 A255E possibly damaging Het
Fam83e T A 7: 45,723,500 D178E probably benign Het
Frem2 A G 3: 53,547,807 L2116S possibly damaging Het
Gm16494 T A 17: 47,016,797 K54* probably null Het
Golgb1 A G 16: 36,918,625 D2442G probably damaging Het
Greb1l G A 18: 10,553,705 A1569T probably damaging Het
Grik5 C G 7: 25,068,064 E64Q probably damaging Het
Gstm5 A G 3: 107,897,986 Y130C probably damaging Het
Gucy2e C G 11: 69,236,168 A160P possibly damaging Het
Hydin A T 8: 110,566,950 T3510S probably benign Het
Itgb2 A G 10: 77,546,115 I84V probably benign Het
Itsn1 A G 16: 91,899,587 Q26R probably damaging Het
Kat6a A G 8: 22,939,311 S1561G probably benign Het
Khnyn G A 14: 55,886,981 V231I probably benign Het
Kif21b A G 1: 136,147,864 D243G probably benign Het
Klk4 T A 7: 43,885,338 N240K probably damaging Het
Knl1 T C 2: 119,070,544 S909P possibly damaging Het
Lamb1 A C 12: 31,323,529 D1419A probably benign Het
Lin9 T A 1: 180,681,194 V421D probably damaging Het
Lipt2 T C 7: 100,160,312 L202P probably benign Het
Mcc A T 18: 44,519,520 I279N probably damaging Het
Mcpt9 C T 14: 56,028,592 V60M probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mylk2 G A 2: 152,917,556 V389M probably damaging Het
Ndufs7 T A 10: 80,256,667 Y203* probably null Het
Nup160 T A 2: 90,685,197 probably null Het
Nup88 G A 11: 70,969,696 R62* probably null Het
Olfr130 T C 17: 38,067,962 S264P probably damaging Het
Olfr145 T A 9: 37,898,326 S307R probably benign Het
Olfr609 T A 7: 103,492,581 Q99L probably damaging Het
Olfr777 G A 10: 129,268,405 A306V probably benign Het
Olfr952 A G 9: 39,426,435 M212T probably benign Het
Os9 T C 10: 127,098,354 N471S probably benign Het
Otof C T 5: 30,371,900 V1757M probably damaging Het
Pald1 T C 10: 61,348,616 T241A probably benign Het
Palm2 A T 4: 57,709,954 T300S probably benign Het
Pappa2 G A 1: 158,814,445 S1347L probably damaging Het
Pccb T C 9: 101,034,779 T27A probably benign Het
Pde4dip A T 3: 97,695,944 V2243D probably damaging Het
Pkd2l2 C A 18: 34,438,201 Q590K probably benign Het
Pmepa1 G A 2: 173,228,327 P145L possibly damaging Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Rnf133 T C 6: 23,649,042 E296G possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb12 T A 1: 106,949,153 D66E probably benign Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Slc46a2 C T 4: 59,911,886 C442Y probably damaging Het
Slc7a1 A G 5: 148,342,059 L301P probably damaging Het
Spg21 A G 9: 65,475,975 T148A probably benign Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Sult1c1 C A 17: 53,973,955 W40L probably benign Het
Sytl2 T C 7: 90,375,769 S322P probably benign Het
Telo2 C A 17: 25,105,148 R531L possibly damaging Het
Thbs3 T C 3: 89,224,590 V719A probably damaging Het
Tlr9 T A 9: 106,224,533 L341Q probably damaging Het
Tmprss5 A G 9: 49,113,248 N230D possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpo C T 12: 30,098,229 V558M probably benign Het
Trex1 T G 9: 109,058,284 Q213P possibly damaging Het
Ttc30a1 T C 2: 75,980,633 T369A probably benign Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Ugt1a6a A G 1: 88,138,864 K131E probably benign Het
Vipr1 T A 9: 121,665,136 probably null Het
Vmn1r22 T C 6: 57,900,875 D39G probably damaging Het
Vmn2r58 A T 7: 41,872,622 C17S probably benign Het
Vps41 T C 13: 18,745,283 Y63H probably damaging Het
Xdh G T 17: 73,910,200 T691N probably benign Het
Zfp518b T C 5: 38,673,627 N345S probably damaging Het
Zfp536 T A 7: 37,568,493 K499N probably damaging Het
Zfp963 A T 8: 69,742,860 probably null Het
Other mutations in Mbd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:Mbd5 APN 2 49250221 missense possibly damaging 0.92
IGL01481:Mbd5 APN 2 49278939 missense possibly damaging 0.90
IGL01639:Mbd5 APN 2 49272308 missense probably damaging 0.98
IGL02063:Mbd5 APN 2 49274767 missense probably damaging 1.00
IGL02157:Mbd5 APN 2 49278975 missense probably benign
IGL02510:Mbd5 APN 2 49257029 missense probably benign 0.05
IGL02932:Mbd5 APN 2 49279448 missense possibly damaging 0.66
IGL02973:Mbd5 APN 2 49313709 missense probably damaging 0.99
IGL03189:Mbd5 APN 2 49257751 missense probably damaging 0.98
F5770:Mbd5 UTSW 2 49316410 missense probably damaging 0.99
R0391:Mbd5 UTSW 2 49272416 missense possibly damaging 0.90
R0427:Mbd5 UTSW 2 49279079 missense probably benign 0.27
R0544:Mbd5 UTSW 2 49257209 missense possibly damaging 0.54
R0883:Mbd5 UTSW 2 49256689 missense possibly damaging 0.94
R1072:Mbd5 UTSW 2 49257191 missense probably damaging 1.00
R1099:Mbd5 UTSW 2 49258144 missense probably benign 0.06
R1400:Mbd5 UTSW 2 49274776 critical splice donor site probably null
R1497:Mbd5 UTSW 2 49257381 missense possibly damaging 0.73
R1552:Mbd5 UTSW 2 49272934 missense probably damaging 0.99
R1675:Mbd5 UTSW 2 49256218 missense possibly damaging 0.90
R1710:Mbd5 UTSW 2 49257032 missense probably benign 0.10
R2085:Mbd5 UTSW 2 49279311 missense possibly damaging 0.90
R2252:Mbd5 UTSW 2 49257686 missense probably damaging 1.00
R2473:Mbd5 UTSW 2 49279341 missense probably benign 0.06
R3966:Mbd5 UTSW 2 49272070 missense possibly damaging 0.46
R4278:Mbd5 UTSW 2 49272293 missense probably damaging 0.97
R4348:Mbd5 UTSW 2 49256327 missense probably benign
R4366:Mbd5 UTSW 2 49272966 missense probably damaging 0.99
R4428:Mbd5 UTSW 2 49279764 missense possibly damaging 0.94
R4556:Mbd5 UTSW 2 49279394 missense probably damaging 1.00
R4689:Mbd5 UTSW 2 49258279 missense possibly damaging 0.46
R4707:Mbd5 UTSW 2 49250156 missense probably damaging 0.99
R4718:Mbd5 UTSW 2 49256402 missense possibly damaging 0.66
R4773:Mbd5 UTSW 2 49274611 missense probably damaging 1.00
R4846:Mbd5 UTSW 2 49256997 missense probably damaging 1.00
R5015:Mbd5 UTSW 2 49258196 missense possibly damaging 0.92
R5059:Mbd5 UTSW 2 49256455 missense probably damaging 0.96
R5268:Mbd5 UTSW 2 49272094 missense possibly damaging 0.92
R5479:Mbd5 UTSW 2 49272905 missense probably damaging 0.99
R5579:Mbd5 UTSW 2 49272814 missense possibly damaging 0.94
R5591:Mbd5 UTSW 2 49274669 missense probably damaging 1.00
R5876:Mbd5 UTSW 2 49274645 missense probably damaging 0.98
R5886:Mbd5 UTSW 2 49272452 missense probably damaging 1.00
R5973:Mbd5 UTSW 2 49272389 missense probably benign 0.23
R6935:Mbd5 UTSW 2 49279812 missense probably damaging 0.97
R7317:Mbd5 UTSW 2 49279743 missense probably benign
V7583:Mbd5 UTSW 2 49316410 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTGCCAACTGTAAAACCTGGTC -3'
(R):5'- CAGTAGGAAAAGCTGCACTGC -3'

Sequencing Primer
(F):5'- ACCTGGTCATATGAATCATGGGAGTC -3'
(R):5'- ACTGCTTGGGGTATTGAGTACATTAC -3'
Posted On2015-09-25