Incidental Mutation 'R4671:Gin1'
ID348399
Institutional Source Beutler Lab
Gene Symbol Gin1
Ensembl Gene ENSMUSG00000026333
Gene Namegypsy retrotransposon integrase 1
Synonyms4930429M06, Zh2c2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4671 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location97770172-97793709 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 97784840 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 154 (P154S)
Ref Sequence ENSEMBL: ENSMUSP00000027571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027571] [ENSMUST00000112844] [ENSMUST00000138142]
Predicted Effect probably damaging
Transcript: ENSMUST00000027571
AA Change: P154S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027571
Gene: ENSMUSG00000026333
AA Change: P154S

DomainStartEndE-ValueType
low complexity region 63 73 N/A INTRINSIC
SCOP:d1exqa_ 112 208 2e-5 SMART
low complexity region 254 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112844
AA Change: P243S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000108464
Gene: ENSMUSG00000026333
AA Change: P243S

DomainStartEndE-ValueType
low complexity region 63 73 N/A INTRINSIC
PDB:4IKF|B 84 289 3e-8 PDB
SCOP:d1exqa_ 145 297 4e-16 SMART
low complexity region 343 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138142
Predicted Effect probably benign
Transcript: ENSMUST00000189031
Meta Mutation Damage Score 0.034 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,718,859 I637V probably benign Het
Abcc2 T C 19: 43,800,718 S271P probably benign Het
Acod1 T G 14: 103,047,072 M2R probably benign Het
Adamts20 T C 15: 94,403,325 E106G possibly damaging Het
Adgra3 G A 5: 49,979,368 T661M probably damaging Het
Akap13 T A 7: 75,579,564 C161* probably null Het
Akr1c12 A C 13: 4,273,817 S162A possibly damaging Het
Anks1 C A 17: 28,051,578 H805N probably benign Het
Arhgap22 T C 14: 33,362,543 C260R probably damaging Het
Banf1 T C 19: 5,365,844 R33G probably benign Het
Bcas1 T C 2: 170,384,325 K310R probably damaging Het
Cacna1c G T 6: 118,652,058 H1240N probably damaging Het
Cartpt C T 13: 99,900,080 probably null Het
Ccdc127 T A 13: 74,357,045 Y237* probably null Het
Ccnb1ip1 A T 14: 50,792,277 Y109* probably null Het
Cenpj A T 14: 56,553,383 V403E possibly damaging Het
Cps1 A G 1: 67,196,560 Y951C probably damaging Het
Dcakd T C 11: 102,999,808 E51G possibly damaging Het
Dennd4a A T 9: 64,894,407 N944I probably benign Het
Dus3l C T 17: 56,768,566 R430C probably benign Het
Dync2h1 A G 9: 7,169,640 L279P possibly damaging Het
Dzip3 G A 16: 48,979,590 Q112* probably null Het
Eif1ad T A 19: 5,368,191 M1K probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam46c C A 3: 100,473,199 L80F probably benign Het
Fancg T C 4: 43,005,272 E366G probably benign Het
Gm11938 A T 11: 99,603,006 C88S possibly damaging Het
Gm38394 A G 1: 133,657,040 V853A probably benign Het
Gpr183 T C 14: 121,954,737 D124G probably damaging Het
Gucy2g T A 19: 55,238,068 I139F probably damaging Het
Iqub A T 6: 24,479,184 M453K probably benign Het
Jcad A G 18: 4,674,175 T646A probably benign Het
Kif23 A T 9: 61,945,359 D24E probably benign Het
Kmt2c T C 5: 25,366,177 N845S probably damaging Het
Lhx5 G A 5: 120,439,967 S284N probably benign Het
Lipf T G 19: 33,976,676 V389G possibly damaging Het
Lrrc7 C T 3: 158,202,495 probably null Het
Magi1 A G 6: 93,680,787 probably null Het
Mast2 A G 4: 116,308,650 S1287P probably damaging Het
Mepce C T 5: 137,786,643 probably benign Het
Mkrn1 A G 6: 39,405,757 V173A probably damaging Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Naip6 A G 13: 100,294,731 probably null Het
Nsmce3 A T 7: 64,872,782 L46Q probably benign Het
Olfr1294 A T 2: 111,537,935 M118K probably damaging Het
Olfr354 G A 2: 36,907,393 C149Y probably benign Het
Olfr531 T G 7: 140,400,305 Y247S probably damaging Het
Olfr681 T C 7: 105,122,306 L283P probably damaging Het
Olfr78 A G 7: 102,742,601 V134A probably damaging Het
Parp14 A G 16: 35,858,321 F426L probably benign Het
Pcf11 A T 7: 92,657,529 S1144T possibly damaging Het
Prpf3 T A 3: 95,851,664 T59S possibly damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptk7 A G 17: 46,574,466 V678A probably benign Het
Rb1 A G 14: 73,273,676 L331S probably damaging Het
Sell A G 1: 164,065,473 Y86C probably damaging Het
Serpina1e G A 12: 103,948,082 R328W probably damaging Het
Sertad3 T G 7: 27,476,666 L175R possibly damaging Het
Stard9 G T 2: 120,698,640 G1793W probably damaging Het
Stra6 T C 9: 58,149,234 I383T probably benign Het
Tcf7l1 A G 6: 72,649,178 L154P probably damaging Het
Tonsl A T 15: 76,623,410 D55E probably benign Het
Ttc21b A G 2: 66,226,913 S572P possibly damaging Het
Ttc7 T A 17: 87,346,620 L575Q probably damaging Het
Ubl4b C T 3: 107,554,878 S22N probably damaging Het
Ubr4 T C 4: 139,436,191 V2634A possibly damaging Het
Zfp46 A C 4: 136,290,173 D106A probably damaging Het
Zfp951 A C 5: 104,814,701 I333S probably benign Het
Other mutations in Gin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01479:Gin1 APN 1 97792372 missense possibly damaging 0.95
IGL01508:Gin1 APN 1 97777437 missense probably benign
IGL01874:Gin1 APN 1 97783072 missense probably damaging 1.00
R0136:Gin1 UTSW 1 97783016 missense possibly damaging 0.86
R0299:Gin1 UTSW 1 97783016 missense possibly damaging 0.86
R1302:Gin1 UTSW 1 97775589 nonsense probably null
R1607:Gin1 UTSW 1 97786150 missense probably damaging 1.00
R1675:Gin1 UTSW 1 97786055 nonsense probably null
R1739:Gin1 UTSW 1 97786104 missense probably damaging 0.99
R1769:Gin1 UTSW 1 97792437 missense probably benign 0.02
R1817:Gin1 UTSW 1 97785226 splice site probably null
R1818:Gin1 UTSW 1 97785226 splice site probably null
R1819:Gin1 UTSW 1 97785226 splice site probably null
R1907:Gin1 UTSW 1 97775447 unclassified probably benign
R2325:Gin1 UTSW 1 97792561 missense probably damaging 1.00
R4206:Gin1 UTSW 1 97792420 missense possibly damaging 0.90
R4571:Gin1 UTSW 1 97785076 missense probably damaging 1.00
R4576:Gin1 UTSW 1 97792339 missense probably damaging 1.00
R4670:Gin1 UTSW 1 97784840 missense probably damaging 1.00
R5659:Gin1 UTSW 1 97775532 missense possibly damaging 0.95
R6360:Gin1 UTSW 1 97792539 missense possibly damaging 0.90
R7035:Gin1 UTSW 1 97792375 missense possibly damaging 0.92
R7229:Gin1 UTSW 1 97785151 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGAAGACAAAATCTGGGTTTCTTG -3'
(R):5'- ACGCAAGGATTCCGATTGAAC -3'

Sequencing Primer
(F):5'- CAGAGGGAAAGTGTGAACTT -3'
(R):5'- GCAAGGATTCCGATTGAACATTTGG -3'
Posted On2015-10-08