Incidental Mutation 'R4671:Fancg'
ID348412
Institutional Source Beutler Lab
Gene Symbol Fancg
Ensembl Gene ENSMUSG00000028453
Gene NameFanconi anemia, complementation group G
SynonymsXrcc9
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.435) question?
Stock #R4671 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location43002343-43010506 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43005272 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 366 (E366G)
Ref Sequence ENSEMBL: ENSMUSP00000030165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030164] [ENSMUST00000030165]
Predicted Effect probably benign
Transcript: ENSMUST00000030164
SMART Domains Protein: ENSMUSP00000030164
Gene: ENSMUSG00000028452

DomainStartEndE-ValueType
CDC48_N 25 108 6.85e-27 SMART
CDC48_2 125 191 3.77e-15 SMART
AAA 237 373 7.87e-24 SMART
AAA 510 649 2e-25 SMART
Pfam:Vps4_C 710 762 3.5e-7 PFAM
low complexity region 775 794 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000030165
AA Change: E366G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000030165
Gene: ENSMUSG00000028453
AA Change: E366G

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
low complexity region 131 144 N/A INTRINSIC
low complexity region 164 179 N/A INTRINSIC
low complexity region 190 199 N/A INTRINSIC
Pfam:TPR_1 251 280 4.1e-6 PFAM
Pfam:TPR_2 251 281 7.3e-5 PFAM
Pfam:TPR_8 251 281 4.5e-3 PFAM
low complexity region 302 317 N/A INTRINSIC
low complexity region 401 418 N/A INTRINSIC
Blast:TPR 458 491 4e-9 BLAST
Blast:TPR 518 550 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148182
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group G. [provided by RefSeq, Jul 2008]
PHENOTYPE: Females and males homozygous for targeted null mutations exhibit hypogonadism and reduced fertility. Cytogeneic analysis showed somatic chromosome aberrations occur at a higher spontaneous rate and are easier to induce than in normal cells. Cells are also more sensitive to mitomycin C. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,718,859 I637V probably benign Het
Abcc2 T C 19: 43,800,718 S271P probably benign Het
Acod1 T G 14: 103,047,072 M2R probably benign Het
Adamts20 T C 15: 94,403,325 E106G possibly damaging Het
Adgra3 G A 5: 49,979,368 T661M probably damaging Het
Akap13 T A 7: 75,579,564 C161* probably null Het
Akr1c12 A C 13: 4,273,817 S162A possibly damaging Het
Anks1 C A 17: 28,051,578 H805N probably benign Het
Arhgap22 T C 14: 33,362,543 C260R probably damaging Het
Banf1 T C 19: 5,365,844 R33G probably benign Het
Bcas1 T C 2: 170,384,325 K310R probably damaging Het
Cacna1c G T 6: 118,652,058 H1240N probably damaging Het
Cartpt C T 13: 99,900,080 probably null Het
Ccdc127 T A 13: 74,357,045 Y237* probably null Het
Ccnb1ip1 A T 14: 50,792,277 Y109* probably null Het
Cenpj A T 14: 56,553,383 V403E possibly damaging Het
Cps1 A G 1: 67,196,560 Y951C probably damaging Het
Dcakd T C 11: 102,999,808 E51G possibly damaging Het
Dennd4a A T 9: 64,894,407 N944I probably benign Het
Dus3l C T 17: 56,768,566 R430C probably benign Het
Dync2h1 A G 9: 7,169,640 L279P possibly damaging Het
Dzip3 G A 16: 48,979,590 Q112* probably null Het
Eif1ad T A 19: 5,368,191 M1K probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam46c C A 3: 100,473,199 L80F probably benign Het
Gin1 C T 1: 97,784,840 P154S probably damaging Het
Gm11938 A T 11: 99,603,006 C88S possibly damaging Het
Gm38394 A G 1: 133,657,040 V853A probably benign Het
Gpr183 T C 14: 121,954,737 D124G probably damaging Het
Gucy2g T A 19: 55,238,068 I139F probably damaging Het
Iqub A T 6: 24,479,184 M453K probably benign Het
Jcad A G 18: 4,674,175 T646A probably benign Het
Kif23 A T 9: 61,945,359 D24E probably benign Het
Kmt2c T C 5: 25,366,177 N845S probably damaging Het
Lhx5 G A 5: 120,439,967 S284N probably benign Het
Lipf T G 19: 33,976,676 V389G possibly damaging Het
Lrrc7 C T 3: 158,202,495 probably null Het
Magi1 A G 6: 93,680,787 probably null Het
Mast2 A G 4: 116,308,650 S1287P probably damaging Het
Mepce C T 5: 137,786,643 probably benign Het
Mkrn1 A G 6: 39,405,757 V173A probably damaging Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Naip6 A G 13: 100,294,731 probably null Het
Nsmce3 A T 7: 64,872,782 L46Q probably benign Het
Olfr1294 A T 2: 111,537,935 M118K probably damaging Het
Olfr354 G A 2: 36,907,393 C149Y probably benign Het
Olfr531 T G 7: 140,400,305 Y247S probably damaging Het
Olfr681 T C 7: 105,122,306 L283P probably damaging Het
Olfr78 A G 7: 102,742,601 V134A probably damaging Het
Parp14 A G 16: 35,858,321 F426L probably benign Het
Pcf11 A T 7: 92,657,529 S1144T possibly damaging Het
Prpf3 T A 3: 95,851,664 T59S possibly damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptk7 A G 17: 46,574,466 V678A probably benign Het
Rb1 A G 14: 73,273,676 L331S probably damaging Het
Sell A G 1: 164,065,473 Y86C probably damaging Het
Serpina1e G A 12: 103,948,082 R328W probably damaging Het
Sertad3 T G 7: 27,476,666 L175R possibly damaging Het
Stard9 G T 2: 120,698,640 G1793W probably damaging Het
Stra6 T C 9: 58,149,234 I383T probably benign Het
Tcf7l1 A G 6: 72,649,178 L154P probably damaging Het
Tonsl A T 15: 76,623,410 D55E probably benign Het
Ttc21b A G 2: 66,226,913 S572P possibly damaging Het
Ttc7 T A 17: 87,346,620 L575Q probably damaging Het
Ubl4b C T 3: 107,554,878 S22N probably damaging Het
Ubr4 T C 4: 139,436,191 V2634A possibly damaging Het
Zfp46 A C 4: 136,290,173 D106A probably damaging Het
Zfp951 A C 5: 104,814,701 I333S probably benign Het
Other mutations in Fancg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Fancg APN 4 43003910 nonsense probably null
IGL02072:Fancg APN 4 43007062 missense probably benign 0.00
IGL02184:Fancg APN 4 43006872 missense possibly damaging 0.79
IGL02989:Fancg APN 4 43007121 splice site probably benign
R0671:Fancg UTSW 4 43002998 missense probably benign 0.00
R1581:Fancg UTSW 4 43007039 missense probably damaging 1.00
R1853:Fancg UTSW 4 43009727 missense probably benign 0.00
R2046:Fancg UTSW 4 43004604 missense probably damaging 1.00
R2519:Fancg UTSW 4 43008787 missense probably damaging 1.00
R4282:Fancg UTSW 4 43003830 missense probably damaging 1.00
R4397:Fancg UTSW 4 43008897 missense probably benign 0.02
R4583:Fancg UTSW 4 43002991 missense probably benign
R4887:Fancg UTSW 4 43006866 missense probably benign 0.18
R5309:Fancg UTSW 4 43003019 missense probably benign 0.23
R5312:Fancg UTSW 4 43003019 missense probably benign 0.23
R5325:Fancg UTSW 4 43006564 missense probably damaging 0.99
R5379:Fancg UTSW 4 43002998 missense probably benign 0.00
R5386:Fancg UTSW 4 43007076 nonsense probably null
R5649:Fancg UTSW 4 43008736 missense probably damaging 1.00
R5788:Fancg UTSW 4 43007130 intron probably benign
R5802:Fancg UTSW 4 43006582 missense probably benign
R6217:Fancg UTSW 4 43010084 missense probably benign 0.03
R6698:Fancg UTSW 4 43007034 missense probably benign 0.00
R7092:Fancg UTSW 4 43004831 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATGGCCCCAGTATCAAGCAG -3'
(R):5'- GGGACCTGAAATGGAGTCTC -3'

Sequencing Primer
(F):5'- AGCAGAGAGAACTGGTTCCCC -3'
(R):5'- ACCTGAAATGGAGTCTCTTTGC -3'
Posted On2015-10-08