Incidental Mutation 'R4667:Ankhd1'
ID352094
Institutional Source Beutler Lab
Gene Symbol Ankhd1
Ensembl Gene ENSMUSG00000024483
Gene Nameankyrin repeat and KH domain containing 1
Synonyms
MMRRC Submission 042012-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.414) question?
Stock #R4667 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location36559987-36665917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 36648021 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 2042 (P2042Q)
Ref Sequence ENSEMBL: ENSMUSP00000120290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006205] [ENSMUST00000142977] [ENSMUST00000155329]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006205
AA Change: P2042Q

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000006205
Gene: ENSMUSG00000024483
AA Change: P2042Q

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000037072
AA Change: P531Q
SMART Domains Protein: ENSMUSP00000040300
Gene: ENSMUSG00000024483
AA Change: P531Q

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
low complexity region 28 47 N/A INTRINSIC
low complexity region 75 94 N/A INTRINSIC
KH 183 253 5.04e-13 SMART
low complexity region 458 491 N/A INTRINSIC
low complexity region 531 547 N/A INTRINSIC
low complexity region 554 571 N/A INTRINSIC
low complexity region 824 836 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000140061
AA Change: P54Q
SMART Domains Protein: ENSMUSP00000121811
Gene: ENSMUSG00000024483
AA Change: P54Q

DomainStartEndE-ValueType
low complexity region 54 70 N/A INTRINSIC
low complexity region 77 94 N/A INTRINSIC
low complexity region 355 375 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000142977
AA Change: P2042Q

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120290
Gene: ENSMUSG00000024483
AA Change: P2042Q

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152940
Predicted Effect probably benign
Transcript: ENSMUST00000155329
AA Change: P2042Q

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000123270
Gene: ENSMUSG00000024483
AA Change: P2042Q

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2342 2362 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik G T 17: 28,908,313 Q241K possibly damaging Het
Acad8 A G 9: 26,990,627 L147P probably damaging Het
Adgra3 T A 5: 49,978,956 Y729F possibly damaging Het
Ago2 A G 15: 73,146,416 Y58H probably damaging Het
Akap13 A G 7: 75,729,094 T2128A probably damaging Het
Akap2 A T 4: 57,855,655 D328V possibly damaging Het
Arhgef15 T C 11: 68,954,561 K155R probably benign Het
Atp10b T C 11: 43,247,518 F1209L probably damaging Het
B130006D01Rik A T 11: 95,726,509 probably benign Het
Bmpr2 T C 1: 59,867,716 L656S probably damaging Het
Btbd17 A G 11: 114,793,857 F119L possibly damaging Het
Ccdc191 G T 16: 43,931,283 K267N probably damaging Het
Ceacam20 T C 7: 19,986,027 Y495H probably damaging Het
Celf2 T C 2: 6,721,528 I47V probably benign Het
Chd9 T C 8: 91,033,800 S2058P possibly damaging Het
Clcn6 T C 4: 148,024,167 E135G possibly damaging Het
Cntn1 T A 15: 92,295,079 N687K probably damaging Het
Col1a2 A T 6: 4,512,412 M99L unknown Het
Cpeb2 T C 5: 43,233,892 probably benign Het
Csn1s2b A G 5: 87,822,311 T134A possibly damaging Het
Cst13 A T 2: 148,823,081 probably benign Het
Cyp2c66 T A 19: 39,176,656 D360E probably damaging Het
Dhx8 A G 11: 101,738,161 S179G unknown Het
Dip2b A G 15: 100,151,360 I212V probably benign Het
Dnah9 G A 11: 66,155,531 H64Y probably benign Het
Dnal1 T C 12: 84,136,700 probably benign Het
Dse T G 10: 34,153,012 Y694S probably damaging Het
Dync2h1 T C 9: 7,051,411 I3175V probably benign Het
Elf5 A G 2: 103,449,060 N209D probably damaging Het
Elovl1 A G 4: 118,430,787 Y40C probably damaging Het
Erp27 T C 6: 136,908,152 E216G possibly damaging Het
F5 G A 1: 164,174,186 V153I probably benign Het
Fam186a G A 15: 99,944,532 T1277I possibly damaging Het
Fam90a1a A T 8: 21,963,346 H239L possibly damaging Het
Fchsd2 G T 7: 101,250,449 R334L probably damaging Het
Fermt3 T C 19: 7,002,920 Y369C probably damaging Het
Fhod3 C T 18: 25,066,338 P689S probably benign Het
Fnbp1l G T 3: 122,556,567 Q332K probably benign Het
Frem3 T C 8: 80,663,420 S1767P probably damaging Het
Ggt5 T C 10: 75,603,031 L121P probably damaging Het
Gm609 A G 16: 45,444,163 S11P probably benign Het
Gphn T C 12: 78,454,817 S119P probably damaging Het
Herc2 A G 7: 56,131,253 D1222G probably damaging Het
Hmx3 T C 7: 131,544,382 I273T possibly damaging Het
Hnrnpu A G 1: 178,332,181 probably benign Het
Hspg2 C T 4: 137,539,645 T1987I possibly damaging Het
Ighv1-22 T A 12: 114,746,451 Q58L probably damaging Het
Ighv14-3 T A 12: 114,060,255 I7F probably benign Het
Kcns3 C A 12: 11,091,783 R305L probably damaging Het
Kcnu1 C T 8: 25,910,921 A699V possibly damaging Het
Kif22 A C 7: 127,033,328 L270W probably damaging Het
Lrp2 G T 2: 69,489,298 H1960Q probably benign Het
March7 C T 2: 60,241,050 Q94* probably null Het
Mcoln3 A T 3: 146,131,204 I264F probably benign Het
Mdn1 A C 4: 32,679,572 T706P probably damaging Het
Mfsd2b A G 12: 4,867,636 C137R probably benign Het
Mmp25 A G 17: 23,644,607 V83A probably benign Het
Mocos T C 18: 24,666,434 Y242H probably benign Het
Msh6 T C 17: 87,984,806 S330P possibly damaging Het
Mtus2 T C 5: 148,298,260 S1156P possibly damaging Het
Muc5b G A 7: 141,842,379 R124H unknown Het
Mybbp1a G A 11: 72,447,971 E775K possibly damaging Het
Myo10 A G 15: 25,793,153 E1272G possibly damaging Het
Nars A G 18: 64,505,231 S254P possibly damaging Het
Ncapd2 A G 6: 125,184,518 I211T possibly damaging Het
Ncoa7 A T 10: 30,690,790 W582R probably damaging Het
Npr3 T A 15: 11,905,467 D58V possibly damaging Het
Nr3c1 G T 18: 39,428,727 T430K probably benign Het
Odf2l A G 3: 145,128,040 T111A probably benign Het
Ogdh G T 11: 6,340,600 C406F probably benign Het
Olfml2a T G 2: 38,949,010 S190A probably damaging Het
Olfr148 T C 9: 39,613,738 M57T probably damaging Het
Olfr243 A G 7: 103,716,638 T15A probably benign Het
Olfr870 T C 9: 20,171,098 I158V probably benign Het
Olfr965 G T 9: 39,719,709 V161F probably benign Het
Optn T C 2: 5,033,139 K415E probably benign Het
Perm1 C A 4: 156,220,206 S803* probably null Het
Pex14 T C 4: 148,984,085 T84A probably benign Het
Pih1d2 T A 9: 50,620,952 Y103* probably null Het
Pikfyve T A 1: 65,250,273 C1235S probably damaging Het
Polr1a A G 6: 71,917,821 N171S probably benign Het
Prrx1 A G 1: 163,254,047 S201P probably benign Het
Psme2b A T 11: 48,945,666 N151K probably benign Het
Serpinb5 A T 1: 106,872,295 T72S probably benign Het
Sgsm1 A G 5: 113,260,047 probably null Het
Sipa1l2 T C 8: 125,453,470 R1063G possibly damaging Het
Slc19a3 T C 1: 83,022,799 T166A probably benign Het
Slc5a4b T C 10: 76,075,045 Y319C possibly damaging Het
Stard3nl T A 13: 19,376,519 N29Y probably damaging Het
Sult6b2 G T 6: 142,801,695 C109* probably null Het
Tcf25 A G 8: 123,397,025 E467G possibly damaging Het
Tmem177 A T 1: 119,910,220 V243D probably benign Het
Tmem2 G A 19: 21,797,351 R119H probably benign Het
Tmem2 C T 19: 21,844,781 A1180V probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tspan11 T A 6: 127,943,715 C208* probably null Het
Ttc1 A G 11: 43,745,317 V33A probably benign Het
Uck1 T A 2: 32,256,034 H283L probably damaging Het
Utrn A C 10: 12,698,053 V1091G probably benign Het
Vmn1r11 A T 6: 57,137,498 H49L probably damaging Het
Vmn1r160 G T 7: 22,872,053 S277I probably benign Het
Vmn1r18 A T 6: 57,390,084 S162T probably benign Het
Vps37b A G 5: 124,010,732 L80P probably damaging Het
Wfdc3 T C 2: 164,743,086 M1V probably null Het
Wrn A T 8: 33,324,338 N116K probably benign Het
Wscd2 G T 5: 113,577,272 G391V probably damaging Het
Zcchc11 G A 4: 108,495,159 E357K probably damaging Het
Zfp286 A G 11: 62,780,602 V215A probably benign Het
Zfp568 A G 7: 30,023,277 H549R probably damaging Het
Other mutations in Ankhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ankhd1 APN 18 36665459 unclassified probably benign
IGL00927:Ankhd1 APN 18 36632072 missense probably benign 0.01
IGL01367:Ankhd1 APN 18 36578643 missense probably benign 0.16
IGL01624:Ankhd1 APN 18 36658013 missense probably damaging 1.00
IGL01725:Ankhd1 APN 18 36648153 missense probably benign 0.04
IGL01767:Ankhd1 APN 18 36648374 missense probably damaging 1.00
IGL02005:Ankhd1 APN 18 36648426 missense probably damaging 1.00
IGL02009:Ankhd1 APN 18 36624661 missense probably damaging 1.00
IGL02246:Ankhd1 APN 18 36656726 missense probably damaging 1.00
IGL02336:Ankhd1 APN 18 36594814 missense probably damaging 0.97
IGL02628:Ankhd1 APN 18 36647703 missense probably benign 0.00
IGL02644:Ankhd1 APN 18 36578775 critical splice donor site probably null
IGL02735:Ankhd1 APN 18 36648546 missense probably benign 0.00
IGL02877:Ankhd1 APN 18 36594823 missense probably damaging 1.00
IGL03129:Ankhd1 APN 18 36658008 nonsense probably null
IGL03163:Ankhd1 APN 18 36647628 missense probably damaging 0.97
IGL03182:Ankhd1 APN 18 36578774 missense probably benign 0.06
IGL03184:Ankhd1 APN 18 36647777 missense probably damaging 1.00
IGL03398:Ankhd1 APN 18 36656837 splice site probably benign
FR4304:Ankhd1 UTSW 18 36560924 small insertion probably benign
R0051:Ankhd1 UTSW 18 36647188 unclassified probably benign
R0089:Ankhd1 UTSW 18 36640356 missense probably damaging 0.99
R0105:Ankhd1 UTSW 18 36646766 missense probably damaging 1.00
R0149:Ankhd1 UTSW 18 36647214 missense probably damaging 1.00
R0243:Ankhd1 UTSW 18 36634734 missense probably damaging 1.00
R0322:Ankhd1 UTSW 18 36658008 nonsense probably null
R0361:Ankhd1 UTSW 18 36647214 missense probably damaging 1.00
R0389:Ankhd1 UTSW 18 36644599 missense possibly damaging 0.48
R0418:Ankhd1 UTSW 18 36634300 missense probably damaging 1.00
R0443:Ankhd1 UTSW 18 36644599 missense possibly damaging 0.48
R0540:Ankhd1 UTSW 18 36640280 missense probably damaging 1.00
R0607:Ankhd1 UTSW 18 36640280 missense probably damaging 1.00
R0738:Ankhd1 UTSW 18 36645249 splice site probably benign
R1127:Ankhd1 UTSW 18 36634346 missense probably damaging 1.00
R1434:Ankhd1 UTSW 18 36625159 missense probably benign 0.09
R1742:Ankhd1 UTSW 18 36625265 missense probably damaging 1.00
R1776:Ankhd1 UTSW 18 36647308 missense probably benign 0.17
R1856:Ankhd1 UTSW 18 36644527 missense probably benign 0.00
R1923:Ankhd1 UTSW 18 36648030 missense probably benign 0.08
R2044:Ankhd1 UTSW 18 36645113 missense probably benign 0.31
R2112:Ankhd1 UTSW 18 36641626 missense probably damaging 1.00
R2115:Ankhd1 UTSW 18 36634308 missense probably damaging 1.00
R2136:Ankhd1 UTSW 18 36647621 missense probably benign
R2196:Ankhd1 UTSW 18 36648379 missense probably damaging 1.00
R2291:Ankhd1 UTSW 18 36644333 missense probably benign 0.31
R2305:Ankhd1 UTSW 18 36642926 missense possibly damaging 0.59
R2309:Ankhd1 UTSW 18 36624765 missense probably damaging 1.00
R2519:Ankhd1 UTSW 18 36578543 intron probably null
R2958:Ankhd1 UTSW 18 36634729 missense probably damaging 1.00
R3978:Ankhd1 UTSW 18 36647613 missense probably damaging 0.96
R3980:Ankhd1 UTSW 18 36647613 missense probably damaging 0.96
R4159:Ankhd1 UTSW 18 36589540 missense possibly damaging 0.91
R4199:Ankhd1 UTSW 18 36661048 unclassified probably benign
R4323:Ankhd1 UTSW 18 36578633 missense probably damaging 1.00
R4356:Ankhd1 UTSW 18 36643043 nonsense probably null
R4496:Ankhd1 UTSW 18 36560786 missense probably damaging 0.98
R4551:Ankhd1 UTSW 18 36655507 unclassified probably null
R4590:Ankhd1 UTSW 18 36583644 missense probably damaging 1.00
R4889:Ankhd1 UTSW 18 36578734 missense probably null 0.00
R4923:Ankhd1 UTSW 18 36589452 missense probably damaging 1.00
R5091:Ankhd1 UTSW 18 36625027 missense possibly damaging 0.68
R5254:Ankhd1 UTSW 18 36656715 missense probably benign 0.05
R5314:Ankhd1 UTSW 18 36561058 splice site probably null
R5336:Ankhd1 UTSW 18 36646716 missense probably damaging 1.00
R5367:Ankhd1 UTSW 18 36589408 missense probably damaging 1.00
R5384:Ankhd1 UTSW 18 36591495 missense probably damaging 1.00
R5385:Ankhd1 UTSW 18 36591495 missense probably damaging 1.00
R5387:Ankhd1 UTSW 18 36634644 missense probably damaging 1.00
R5458:Ankhd1 UTSW 18 36648485 missense probably benign 0.01
R5599:Ankhd1 UTSW 18 36560807 missense probably damaging 0.98
R5659:Ankhd1 UTSW 18 36561050 missense probably damaging 1.00
R5750:Ankhd1 UTSW 18 36624902 missense probably benign 0.00
R5874:Ankhd1 UTSW 18 36640269 missense possibly damaging 0.92
R5894:Ankhd1 UTSW 18 36647524 missense probably damaging 0.99
R5969:Ankhd1 UTSW 18 36600834 missense probably damaging 1.00
R6133:Ankhd1 UTSW 18 36625126 missense possibly damaging 0.77
R6190:Ankhd1 UTSW 18 36611809 missense possibly damaging 0.84
R6247:Ankhd1 UTSW 18 36654146 missense probably benign 0.00
R6512:Ankhd1 UTSW 18 36591456 missense probably damaging 1.00
R6649:Ankhd1 UTSW 18 36600783 unclassified probably null
R6653:Ankhd1 UTSW 18 36600783 unclassified probably null
R6763:Ankhd1 UTSW 18 36642969 missense probably benign 0.31
R6976:Ankhd1 UTSW 18 36648254 missense probably benign 0.00
X0027:Ankhd1 UTSW 18 36624832 missense probably damaging 1.00
X0065:Ankhd1 UTSW 18 36578764 nonsense probably null
X0066:Ankhd1 UTSW 18 36646704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTCCGTGACAAGCACTAG -3'
(R):5'- GGGTGATGCCAAAGTCAATG -3'

Sequencing Primer
(F):5'- CGTGACAAGCACTAGTAGTTCCTTG -3'
(R):5'- CCAAAGTCAATGGAGCAGTTTCTG -3'
Posted On2015-10-08