Incidental Mutation 'R4716:Sos2'
ID354063
Institutional Source Beutler Lab
Gene Symbol Sos2
Ensembl Gene ENSMUSG00000034801
Gene NameSOS Ras/Rho guanine nucleotide exchange factor 2
Synonyms
MMRRC Submission 041983-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4716 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location69583762-69681852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69607371 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 703 (I703V)
Ref Sequence ENSEMBL: ENSMUSP00000138589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035773] [ENSMUST00000182396] [ENSMUST00000183277]
Predicted Effect probably benign
Transcript: ENSMUST00000035773
AA Change: I735V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000044866
Gene: ENSMUSG00000034801
AA Change: I735V

DomainStartEndE-ValueType
Pfam:Histone 54 169 3.7e-13 PFAM
RhoGEF 203 388 1.98e-35 SMART
PH 443 547 1.54e-14 SMART
RasGEFN 595 740 5.8e-52 SMART
RasGEF 775 1019 2.51e-92 SMART
low complexity region 1079 1099 N/A INTRINSIC
low complexity region 1144 1152 N/A INTRINSIC
low complexity region 1173 1192 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
low complexity region 1254 1269 N/A INTRINSIC
low complexity region 1276 1292 N/A INTRINSIC
low complexity region 1301 1309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182396
AA Change: I703V

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000138589
Gene: ENSMUSG00000034801
AA Change: I703V

DomainStartEndE-ValueType
Pfam:Histone 97 169 1e-9 PFAM
Pfam:RhoGEF 203 344 1.6e-12 PFAM
PH 410 514 1.54e-14 SMART
RasGEFN 562 707 5.8e-52 SMART
RasGEF 742 986 2.51e-92 SMART
low complexity region 1046 1066 N/A INTRINSIC
low complexity region 1111 1119 N/A INTRINSIC
low complexity region 1140 1159 N/A INTRINSIC
low complexity region 1167 1192 N/A INTRINSIC
low complexity region 1221 1236 N/A INTRINSIC
low complexity region 1243 1259 N/A INTRINSIC
low complexity region 1268 1276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183277
AA Change: I736V

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000138793
Gene: ENSMUSG00000034801
AA Change: I736V

DomainStartEndE-ValueType
Pfam:Histone 97 169 8.9e-11 PFAM
RhoGEF 203 388 1.98e-35 SMART
PH 443 547 1.54e-14 SMART
RasGEFN 595 740 5.8e-52 SMART
RasGEF 775 1019 2.51e-92 SMART
low complexity region 1079 1099 N/A INTRINSIC
low complexity region 1144 1152 N/A INTRINSIC
low complexity region 1173 1192 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
low complexity region 1254 1269 N/A INTRINSIC
low complexity region 1276 1292 N/A INTRINSIC
low complexity region 1301 1309 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulatory protein that is involved in the positive regulation of ras proteins. Mutations in this gene are associated with Noonan Syndrome-9. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no discernable phenotype; mice are viable and fertile with normal embryonic and adult histopathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,960,342 S233P probably damaging Het
Abi3bp C T 16: 56,650,725 R578* probably null Het
Adam8 T A 7: 139,983,938 D717V probably benign Het
Aknad1 T C 3: 108,775,101 probably null Het
Alk A T 17: 72,205,942 W341R probably damaging Het
Ankdd1b G A 13: 96,454,583 Q101* probably null Het
Anpep A C 7: 79,826,632 S829A probably benign Het
Ate1 A T 7: 130,513,781 C72S probably damaging Het
Atp6v0a4 G A 6: 38,061,064 L533F probably damaging Het
Bach1 T C 16: 87,715,379 probably benign Het
Baz2b T C 2: 59,969,255 D240G probably benign Het
Cdc14b C T 13: 64,209,200 S21N probably damaging Het
Cdh3 A G 8: 106,543,888 I466V probably benign Het
Cog1 A G 11: 113,657,097 E137G probably damaging Het
Col4a2 A G 8: 11,402,224 D180G probably damaging Het
Cyp2c40 A T 19: 39,802,661 probably null Het
Dclk2 C T 3: 86,919,881 R97H probably damaging Het
Ddx52 T C 11: 83,955,205 probably null Het
Dhx58 C T 11: 100,696,971 probably null Het
Dmp1 T A 5: 104,212,561 S368T probably damaging Het
Dnah17 C A 11: 118,073,648 V2435L probably benign Het
Dnajc7 A G 11: 100,619,576 V10A probably benign Het
Dscam G T 16: 96,619,571 T1705K possibly damaging Het
Dscaml1 G A 9: 45,450,592 V217M probably damaging Het
Dync2h1 A G 9: 7,142,648 probably null Het
F5 A G 1: 164,193,919 D1321G probably damaging Het
Fam174a C T 1: 95,314,045 P77S probably benign Het
Fars2 G A 13: 36,205,068 R180H probably damaging Het
Fnbp1 T C 2: 31,055,520 T154A probably benign Het
Fsip2 T A 2: 82,974,859 N507K probably damaging Het
Glg1 G T 8: 111,160,775 Y449* probably null Het
Gm15130 A T 2: 111,134,215 Y187* probably null Het
Gm973 A T 1: 59,552,554 K366* probably null Het
Hao1 A G 2: 134,505,620 I255T probably damaging Het
Herc6 T A 6: 57,598,438 V148E probably damaging Het
Hist1h2bj T A 13: 22,043,363 V45E possibly damaging Het
Insm2 T A 12: 55,600,892 C474S possibly damaging Het
Itch T C 2: 155,210,582 probably null Het
Itga2 A G 13: 114,857,373 V748A probably damaging Het
Itga9 T A 9: 118,681,758 S452T probably damaging Het
Kdm4b C A 17: 56,386,178 D338E probably benign Het
Krt40 G A 11: 99,540,219 R155C probably damaging Het
Krtap16-1 A G 11: 99,985,174 V468A probably damaging Het
Lactb2 G A 1: 13,638,395 P143L probably damaging Het
Lrba C A 3: 86,642,714 T2330K probably damaging Het
Lrp2bp A T 8: 46,013,171 I106F probably benign Het
Luzp2 A G 7: 54,835,962 K2E probably damaging Het
Lypd6 T C 2: 50,188,843 probably null Het
Maml1 A T 11: 50,257,867 D1015E probably benign Het
Mdfi T G 17: 47,820,981 D106A possibly damaging Het
Olfm3 T C 3: 115,081,106 M17T probably benign Het
Olfr136 A C 17: 38,335,840 I228L possibly damaging Het
Olfr1394 A G 11: 49,160,890 Y292C probably damaging Het
Olfr894 T A 9: 38,219,418 N198K probably damaging Het
Olfr948 A G 9: 39,319,429 F62L probably benign Het
Otud7b T G 3: 96,150,910 L261V probably damaging Het
P2ry1 A G 3: 61,003,472 N11D probably damaging Het
Pate2 T C 9: 35,685,682 probably benign Het
Pcdhb16 A T 18: 37,479,405 T473S probably benign Het
Per1 A G 11: 69,101,231 E137G probably damaging Het
Phf11d T C 14: 59,353,342 T189A probably benign Het
Pik3r5 C A 11: 68,495,204 S738R possibly damaging Het
Pikfyve A G 1: 65,246,476 Y913C possibly damaging Het
Pkd1 T G 17: 24,576,133 S2265A probably damaging Het
Pkhd1l1 C A 15: 44,556,032 N2964K probably damaging Het
Plch1 T G 3: 63,781,546 D79A probably damaging Het
Pnliprp1 A C 19: 58,740,469 T363P possibly damaging Het
Ppp1r10 T A 17: 35,929,460 D547E probably benign Het
Prkdc T A 16: 15,810,837 I3482K probably benign Het
Ptpn4 A G 1: 119,721,868 Y333H probably damaging Het
Ptpru T A 4: 131,820,968 M73L probably benign Het
Rrp12 A G 19: 41,877,428 Y698H probably damaging Het
Scaf8 T C 17: 3,177,123 F338L unknown Het
Slc17a1 G T 13: 23,880,593 V347L probably benign Het
Slc1a2 T A 2: 102,748,538 V263E probably damaging Het
Slc29a4 T C 5: 142,718,572 V327A probably benign Het
Slc6a3 A C 13: 73,557,076 I229L probably benign Het
Srpk1 T C 17: 28,622,008 T15A probably benign Het
St6gal2 A T 17: 55,510,366 Q510L probably benign Het
Stk24 T C 14: 121,294,718 D289G possibly damaging Het
Taf2 T G 15: 55,065,968 K64T probably benign Het
Tbx3 A G 5: 119,675,670 E257G possibly damaging Het
Tmem102 A T 11: 69,804,196 F317I probably damaging Het
Trav10 A G 14: 53,506,040 S33G possibly damaging Het
Ttn T A 2: 76,915,064 I5214F probably damaging Het
Ube2f T A 1: 91,254,280 L2Q probably damaging Het
Ube4b A G 4: 149,344,612 F857L probably damaging Het
Vmn2r18 T A 5: 151,562,137 I631F possibly damaging Het
Zfp280d T A 9: 72,312,665 S241T possibly damaging Het
Zfp638 T A 6: 83,979,562 L1717* probably null Het
Zfp719 A G 7: 43,591,111 N708D possibly damaging Het
Other mutations in Sos2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Sos2 APN 12 69616849 splice site probably benign
IGL01348:Sos2 APN 12 69618092 missense probably damaging 0.99
IGL01360:Sos2 APN 12 69590800 missense probably benign 0.00
IGL01586:Sos2 APN 12 69607398 missense probably damaging 1.00
IGL01721:Sos2 APN 12 69603867 missense probably damaging 0.99
IGL02024:Sos2 APN 12 69618048 splice site probably benign
IGL02347:Sos2 APN 12 69596746 missense probably benign
IGL02419:Sos2 APN 12 69616990 missense probably benign
IGL02684:Sos2 APN 12 69596666 missense probably damaging 1.00
IGL02719:Sos2 APN 12 69617184 missense probably benign 0.00
IGL03099:Sos2 APN 12 69616359 missense probably damaging 1.00
PIT4131001:Sos2 UTSW 12 69618077 missense probably benign
R0038:Sos2 UTSW 12 69596693 missense probably damaging 1.00
R0233:Sos2 UTSW 12 69617330 missense probably benign 0.00
R0233:Sos2 UTSW 12 69617330 missense probably benign 0.00
R0326:Sos2 UTSW 12 69635685 missense probably damaging 1.00
R1386:Sos2 UTSW 12 69614658 missense probably damaging 1.00
R1472:Sos2 UTSW 12 69585316 unclassified probably null
R1534:Sos2 UTSW 12 69616955 missense probably damaging 1.00
R1861:Sos2 UTSW 12 69617363 missense probably damaging 1.00
R1934:Sos2 UTSW 12 69648541 missense probably damaging 0.99
R1964:Sos2 UTSW 12 69616862 missense possibly damaging 0.51
R2402:Sos2 UTSW 12 69596799 missense possibly damaging 0.95
R2516:Sos2 UTSW 12 69650659 missense probably damaging 0.99
R2571:Sos2 UTSW 12 69635718 missense possibly damaging 0.95
R3423:Sos2 UTSW 12 69603553 missense probably damaging 1.00
R4435:Sos2 UTSW 12 69614699 missense possibly damaging 0.79
R4508:Sos2 UTSW 12 69635661 nonsense probably null
R4595:Sos2 UTSW 12 69616889 missense probably damaging 1.00
R4606:Sos2 UTSW 12 69614606 intron probably benign
R4691:Sos2 UTSW 12 69616328 missense probably damaging 1.00
R4863:Sos2 UTSW 12 69640154 missense probably benign 0.04
R5179:Sos2 UTSW 12 69650728 nonsense probably null
R5319:Sos2 UTSW 12 69627284 missense probably benign 0.22
R5694:Sos2 UTSW 12 69590915 missense probably damaging 0.96
R5877:Sos2 UTSW 12 69596795 missense probably damaging 1.00
R6363:Sos2 UTSW 12 69632111 missense probably benign 0.00
R6465:Sos2 UTSW 12 69596775 missense probably benign 0.01
R6817:Sos2 UTSW 12 69618161 missense probably benign 0.32
R6822:Sos2 UTSW 12 69650649 missense probably damaging 1.00
R7015:Sos2 UTSW 12 69585235 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- TTCCAAAAGTGTTAGCTGCCG -3'
(R):5'- TCAAATACTAGCAAAGCATGTGAAG -3'

Sequencing Primer
(F):5'- CCGTGCGATCTCTATTGGATGAAG -3'
(R):5'- GGTGACTCATGTCTGTAATACCAGC -3'
Posted On2015-10-21