Incidental Mutation 'R4112:Cyp3a25'
ID368262
Institutional Source Beutler Lab
Gene Symbol Cyp3a25
Ensembl Gene ENSMUSG00000029630
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 25
Synonyms
MMRRC Submission 040989-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R4112 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location145977194-146009618 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 146003031 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 55 (D55E)
Ref Sequence ENSEMBL: ENSMUSP00000065585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068317] [ENSMUST00000138870] [ENSMUST00000145062]
Predicted Effect probably benign
Transcript: ENSMUST00000068317
AA Change: D55E

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000065585
Gene: ENSMUSG00000029630
AA Change: D55E

DomainStartEndE-ValueType
Pfam:p450 38 493 9.4e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138870
AA Change: D55E

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000116077
Gene: ENSMUSG00000029630
AA Change: D55E

DomainStartEndE-ValueType
Pfam:p450 38 126 2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145062
AA Change: D55E

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000123615
Gene: ENSMUSG00000029630
AA Change: D55E

DomainStartEndE-ValueType
Pfam:p450 38 148 3.9e-21 PFAM
Meta Mutation Damage Score 0.1264 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.3%
Validation Efficiency 97% (56/58)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
5830411N06Rik G T 7: 140,298,368 G1003* probably null Het
Aamp A G 1: 74,281,227 probably benign Het
Abcb4 A G 5: 8,936,783 probably null Het
Adam6b T A 12: 113,489,636 F24L possibly damaging Het
Alms1 G A 6: 85,620,888 V1368I probably benign Het
Angpt2 T A 8: 18,699,123 Q326L probably damaging Het
Armc9 T A 1: 86,188,939 I327N possibly damaging Het
Bace2 A G 16: 97,436,656 T436A probably benign Het
Ccdc162 T A 10: 41,656,328 E450V possibly damaging Het
Ccdc7b G T 8: 129,085,227 probably benign Het
Cdh17 T C 4: 11,814,628 S728P probably damaging Het
Chia1 T C 3: 106,128,528 L168P probably damaging Het
Cnot1 A C 8: 95,773,618 L111V probably damaging Het
Col14a1 A T 15: 55,363,559 N235I unknown Het
Col2a1 A C 15: 97,983,701 L787R probably benign Het
Dennd6a A T 14: 26,628,518 probably benign Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Etfbkmt T C 6: 149,144,591 probably benign Het
Etfrf1 T C 6: 145,215,372 Y23H probably damaging Het
Gemin4 T A 11: 76,212,819 E372V probably damaging Het
Glyr1 T C 16: 5,018,486 K500E possibly damaging Het
Gm10271 A T 10: 116,968,038 probably benign Het
Gm20775 A T Y: 10,641,878 noncoding transcript Het
Gm5578 A G 6: 112,606,505 noncoding transcript Het
Gxylt2 A G 6: 100,783,206 N234S probably damaging Het
Kcna6 G C 6: 126,739,774 R51G probably damaging Het
Klf17 A G 4: 117,760,701 V153A possibly damaging Het
L3mbtl2 T C 15: 81,681,969 V331A possibly damaging Het
Med1 A T 11: 98,180,087 V110E probably damaging Het
Nsmaf A C 4: 6,417,188 Y535* probably null Het
Pcdh10 G A 3: 45,381,620 V790M probably damaging Het
Phlpp1 A G 1: 106,364,338 T976A probably damaging Het
Prelid3a T C 18: 67,472,897 Y25H probably damaging Het
Ptprk T A 10: 28,475,288 probably null Het
Rbm5 A T 9: 107,765,597 D79E probably damaging Het
Rhox3f G T X: 37,582,019 E140* probably null Het
Rnd3 T A 2: 51,148,230 T78S possibly damaging Het
Sgca T C 11: 94,972,570 T27A possibly damaging Het
Slc10a2 C T 8: 5,105,135 D17N probably benign Het
Snap23 C T 2: 120,584,375 probably benign Het
Sptb T A 12: 76,597,779 T2098S probably damaging Het
Src T A 2: 157,463,026 L165H probably damaging Het
Srr G T 11: 74,913,072 Q20K probably benign Het
Stt3b A T 9: 115,266,138 F275Y probably damaging Het
Sucnr1 C G 3: 60,086,794 R248G probably damaging Het
Thsd7b A T 1: 130,116,619 D1112V probably benign Het
Tmem80 A G 7: 141,333,779 probably benign Het
Top2a C A 11: 99,022,960 K18N probably damaging Het
Ttc24 T A 3: 88,074,639 D40V probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zfp3 T A 11: 70,771,507 S97R probably benign Het
Other mutations in Cyp3a25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Cyp3a25 APN 5 146001463 nonsense probably null
IGL00430:Cyp3a25 APN 5 145993360 missense probably damaging 1.00
IGL00803:Cyp3a25 APN 5 146001443 splice site probably benign
IGL00928:Cyp3a25 APN 5 145986954 missense possibly damaging 0.94
IGL01557:Cyp3a25 APN 5 145984901 missense probably damaging 1.00
IGL01997:Cyp3a25 APN 5 145994956 missense possibly damaging 0.92
IGL02140:Cyp3a25 APN 5 146009463 splice site probably benign
IGL02267:Cyp3a25 APN 5 145998552 missense possibly damaging 0.48
IGL02272:Cyp3a25 APN 5 145993265 intron probably benign
IGL02327:Cyp3a25 APN 5 145986921 missense possibly damaging 0.50
IGL02411:Cyp3a25 APN 5 146001447 critical splice donor site probably benign
IGL02504:Cyp3a25 APN 5 145993331 missense probably benign 0.03
IGL02653:Cyp3a25 APN 5 146003110 missense possibly damaging 0.95
R0378:Cyp3a25 UTSW 5 145986842 missense probably damaging 1.00
R0403:Cyp3a25 UTSW 5 145998513 missense probably damaging 1.00
R0685:Cyp3a25 UTSW 5 145998546 missense probably damaging 1.00
R0725:Cyp3a25 UTSW 5 145994936 missense probably damaging 1.00
R0798:Cyp3a25 UTSW 5 145991533 missense probably damaging 0.98
R1061:Cyp3a25 UTSW 5 145986833 missense probably benign
R1519:Cyp3a25 UTSW 5 146001447 critical splice donor site probably null
R1628:Cyp3a25 UTSW 5 146001463 nonsense probably null
R1822:Cyp3a25 UTSW 5 145984953 missense probably damaging 1.00
R1824:Cyp3a25 UTSW 5 145984953 missense probably damaging 1.00
R1864:Cyp3a25 UTSW 5 145994929 missense probably damaging 0.98
R2062:Cyp3a25 UTSW 5 145986969 splice site probably benign
R2401:Cyp3a25 UTSW 5 145986968 critical splice acceptor site probably null
R2516:Cyp3a25 UTSW 5 146003027 splice site probably null
R3080:Cyp3a25 UTSW 5 145998531 missense probably benign 0.33
R3236:Cyp3a25 UTSW 5 146003128 splice site probably benign
R3694:Cyp3a25 UTSW 5 145989976 splice site probably null
R3730:Cyp3a25 UTSW 5 146003081 missense probably damaging 1.00
R4258:Cyp3a25 UTSW 5 145991438 missense probably damaging 1.00
R4651:Cyp3a25 UTSW 5 145994891 missense probably benign 0.01
R4788:Cyp3a25 UTSW 5 145985082 nonsense probably null
R4899:Cyp3a25 UTSW 5 145977671 missense possibly damaging 0.59
R4926:Cyp3a25 UTSW 5 145991456 missense probably damaging 1.00
R4952:Cyp3a25 UTSW 5 145991524 missense probably benign 0.01
R5270:Cyp3a25 UTSW 5 145981502 missense probably benign 0.36
R5595:Cyp3a25 UTSW 5 145994863 critical splice donor site probably null
R5659:Cyp3a25 UTSW 5 145991546 missense possibly damaging 0.69
R5787:Cyp3a25 UTSW 5 145998503 missense probably benign 0.14
R6307:Cyp3a25 UTSW 5 145994956 missense possibly damaging 0.92
R6380:Cyp3a25 UTSW 5 145998547 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTGAAAGAAATTGCAACTATAGGAA -3'
(R):5'- TACAATTTGGGTTTGATTCTTGCA -3'

Sequencing Primer
(F):5'- CAGGTAGTGATAGCACCTGC -3'
(R):5'- GCAGTTCCTGAGTCATGACTGAC -3'
Posted On2016-01-15