Incidental Mutation 'R4258:Cyp3a25'
ID371054
Institutional Source Beutler Lab
Gene Symbol Cyp3a25
Ensembl Gene ENSMUSG00000029630
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 25
Synonyms
MMRRC Submission 041071-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R4258 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location145977194-146009618 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 145991438 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 266 (K266E)
Ref Sequence ENSEMBL: ENSMUSP00000065585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068317] [ENSMUST00000138870] [ENSMUST00000145062]
Predicted Effect probably damaging
Transcript: ENSMUST00000068317
AA Change: K266E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065585
Gene: ENSMUSG00000029630
AA Change: K266E

DomainStartEndE-ValueType
Pfam:p450 38 493 9.4e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138870
SMART Domains Protein: ENSMUSP00000116077
Gene: ENSMUSG00000029630

DomainStartEndE-ValueType
Pfam:p450 38 126 2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145062
SMART Domains Protein: ENSMUSP00000123615
Gene: ENSMUSG00000029630

DomainStartEndE-ValueType
Pfam:p450 38 148 3.9e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153808
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (60/63)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik T C 9: 105,143,568 I165V probably damaging Het
4932415M13Rik T A 17: 53,724,413 noncoding transcript Het
Ank3 T C 10: 70,004,762 I984T probably benign Het
Arnt2 T C 7: 84,310,955 T204A probably damaging Het
Arsi T C 18: 60,917,316 W424R probably damaging Het
Aspg A T 12: 112,121,253 N346I probably benign Het
Brdt A G 5: 107,359,909 S668G probably damaging Het
Ccdc178 C T 18: 22,017,335 probably null Het
Cfap58 A T 19: 47,949,484 probably null Het
Chaf1a C A 17: 56,056,474 H319Q unknown Het
Colec12 T C 18: 9,720,950 S13P probably damaging Het
Cpne9 C T 6: 113,283,023 probably benign Het
Cyp2c65 A C 19: 39,093,428 D466A probably benign Het
Dennd1b G T 1: 139,062,940 R214L probably damaging Het
Dock9 T C 14: 121,581,442 I1533V probably benign Het
Dynlt1a C T 17: 6,310,909 M102I probably benign Het
Edil3 G T 13: 89,177,153 L220F probably damaging Het
Eml5 A G 12: 98,865,434 Y383H probably benign Het
Epc1 T A 18: 6,450,130 T393S probably benign Het
Fbxo8 A T 8: 56,588,041 D164V probably benign Het
Gbp4 T A 5: 105,136,975 N16I probably damaging Het
Gdf6 G A 4: 9,844,877 V134I probably damaging Het
Gm21876 C T X: 21,174,928 S45N probably damaging Het
Gm5475 A G 15: 100,424,236 probably benign Het
Gm6430 T G 1: 97,024,836 noncoding transcript Het
Ighv9-4 A T 12: 114,300,145 V56E probably damaging Het
Il3ra A T 14: 14,347,961 N36Y probably damaging Het
Kif7 G T 7: 79,710,513 C325* probably null Het
Lipo2 A T 19: 33,730,928 F229I possibly damaging Het
Lrba A G 3: 86,445,349 K1935E probably damaging Het
Mki67 A T 7: 135,695,288 D2672E possibly damaging Het
Mtf1 A G 4: 124,838,783 T545A probably benign Het
Mup6 A T 4: 60,004,812 probably null Het
Myo9b T C 8: 71,355,765 V1672A probably damaging Het
Olfr1164 T A 2: 88,093,018 N306I probably damaging Het
Olfr122 C A 17: 37,772,058 P135Q probably damaging Het
Olfr1280 A T 2: 111,315,638 H53L probably benign Het
Olfr16 C T 1: 172,957,638 T281I possibly damaging Het
Pcdhgb2 A T 18: 37,692,049 I698F probably damaging Het
Pkn3 C T 2: 30,088,560 H665Y probably damaging Het
Ppil6 T A 10: 41,507,535 L99* probably null Het
Psg22 T A 7: 18,724,629 V376E probably damaging Het
Pum1 G A 4: 130,730,280 R201H probably damaging Het
Rasa2 A T 9: 96,557,380 probably benign Het
Schip1 T A 3: 68,618,630 M379K possibly damaging Het
Scn9a A T 2: 66,565,054 probably benign Het
Sh3tc1 C T 5: 35,706,978 A622T probably benign Het
Smarcd2 A T 11: 106,265,250 I292N probably damaging Het
Stab1 G A 14: 31,154,672 R862C possibly damaging Het
Tdrd5 T A 1: 156,259,742 H870L probably benign Het
Tnfaip8 A G 18: 50,090,376 R60G possibly damaging Het
Traf3ip3 C T 1: 193,197,946 R25Q probably damaging Het
Unc5b T C 10: 60,765,371 Y892C probably damaging Het
Vmn2r2 T G 3: 64,134,697 D199A probably damaging Het
Washc2 C A 6: 116,208,241 P12Q probably damaging Het
Zfp286 T C 11: 62,781,070 I121V probably benign Het
Zfp606 T A 7: 12,494,340 probably null Het
Other mutations in Cyp3a25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Cyp3a25 APN 5 146001463 nonsense probably null
IGL00430:Cyp3a25 APN 5 145993360 missense probably damaging 1.00
IGL00803:Cyp3a25 APN 5 146001443 splice site probably benign
IGL00928:Cyp3a25 APN 5 145986954 missense possibly damaging 0.94
IGL01557:Cyp3a25 APN 5 145984901 missense probably damaging 1.00
IGL01997:Cyp3a25 APN 5 145994956 missense possibly damaging 0.92
IGL02140:Cyp3a25 APN 5 146009463 splice site probably benign
IGL02267:Cyp3a25 APN 5 145998552 missense possibly damaging 0.48
IGL02272:Cyp3a25 APN 5 145993265 intron probably benign
IGL02327:Cyp3a25 APN 5 145986921 missense possibly damaging 0.50
IGL02411:Cyp3a25 APN 5 146001447 critical splice donor site probably benign
IGL02504:Cyp3a25 APN 5 145993331 missense probably benign 0.03
IGL02653:Cyp3a25 APN 5 146003110 missense possibly damaging 0.95
R0378:Cyp3a25 UTSW 5 145986842 missense probably damaging 1.00
R0403:Cyp3a25 UTSW 5 145998513 missense probably damaging 1.00
R0685:Cyp3a25 UTSW 5 145998546 missense probably damaging 1.00
R0725:Cyp3a25 UTSW 5 145994936 missense probably damaging 1.00
R0798:Cyp3a25 UTSW 5 145991533 missense probably damaging 0.98
R1061:Cyp3a25 UTSW 5 145986833 missense probably benign
R1519:Cyp3a25 UTSW 5 146001447 critical splice donor site probably null
R1628:Cyp3a25 UTSW 5 146001463 nonsense probably null
R1822:Cyp3a25 UTSW 5 145984953 missense probably damaging 1.00
R1824:Cyp3a25 UTSW 5 145984953 missense probably damaging 1.00
R1864:Cyp3a25 UTSW 5 145994929 missense probably damaging 0.98
R2062:Cyp3a25 UTSW 5 145986969 splice site probably benign
R2401:Cyp3a25 UTSW 5 145986968 critical splice acceptor site probably null
R2516:Cyp3a25 UTSW 5 146003027 splice site probably null
R3080:Cyp3a25 UTSW 5 145998531 missense probably benign 0.33
R3236:Cyp3a25 UTSW 5 146003128 splice site probably benign
R3694:Cyp3a25 UTSW 5 145989976 splice site probably null
R3730:Cyp3a25 UTSW 5 146003081 missense probably damaging 1.00
R4112:Cyp3a25 UTSW 5 146003031 missense probably benign 0.18
R4651:Cyp3a25 UTSW 5 145994891 missense probably benign 0.01
R4788:Cyp3a25 UTSW 5 145985082 nonsense probably null
R4899:Cyp3a25 UTSW 5 145977671 missense possibly damaging 0.59
R4926:Cyp3a25 UTSW 5 145991456 missense probably damaging 1.00
R4952:Cyp3a25 UTSW 5 145991524 missense probably benign 0.01
R5270:Cyp3a25 UTSW 5 145981502 missense probably benign 0.36
R5595:Cyp3a25 UTSW 5 145994863 critical splice donor site probably null
R5659:Cyp3a25 UTSW 5 145991546 missense possibly damaging 0.69
R5787:Cyp3a25 UTSW 5 145998503 missense probably benign 0.14
R6307:Cyp3a25 UTSW 5 145994956 missense possibly damaging 0.92
R6380:Cyp3a25 UTSW 5 145998547 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTAATGACCAAACCTAGAGCAT -3'
(R):5'- GAGTCCAACATTGTGGGGAAT -3'

Sequencing Primer
(F):5'- TCATGACCACATCCTGGAAATCATG -3'
(R):5'- GGTAAGTGTCTGTGAAAACTCCCC -3'
Posted On2016-02-10