Incidental Mutation 'R4901:Plxnb1'
ID376169
Institutional Source Beutler Lab
Gene Symbol Plxnb1
Ensembl Gene ENSMUSG00000053646
Gene Nameplexin B1
Synonyms2900002G15Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4901 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location109095389-109119917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 109104959 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 752 (P752S)
Ref Sequence ENSEMBL: ENSMUSP00000071966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072093] [ENSMUST00000130366] [ENSMUST00000131462]
Predicted Effect probably benign
Transcript: ENSMUST00000072093
AA Change: P752S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000071966
Gene: ENSMUSG00000053646
AA Change: P752S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 35 463 5.84e-101 SMART
PSI 481 534 1.17e-13 SMART
PSI 628 678 6.97e-3 SMART
low complexity region 691 706 N/A INTRINSIC
low complexity region 752 771 N/A INTRINSIC
PSI 1019 1066 2.06e-5 SMART
IPT 1067 1158 7.48e-18 SMART
IPT 1159 1247 3.97e-22 SMART
IPT 1249 1359 6.09e-9 SMART
low complexity region 1483 1494 N/A INTRINSIC
Pfam:Plexin_cytopl 1546 2086 6.5e-230 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130366
SMART Domains Protein: ENSMUSP00000114358
Gene: ENSMUSG00000053646

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sema 35 138 7.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131462
SMART Domains Protein: ENSMUSP00000115265
Gene: ENSMUSG00000053646

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sema 35 138 7.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192117
Predicted Effect silent
Transcript: ENSMUST00000192988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195364
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutants are viable and fertile and show no apparent defects in development, adult histology or basic functional parameters. However, a transitory renal phenotype, characterized by increased ureteric branching and enlarged kidneys, is noted over early stages of renal development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 C T 9: 44,277,657 probably null Het
Arg2 T C 12: 79,147,711 V103A probably damaging Het
Bicra T A 7: 15,987,601 T664S possibly damaging Het
Bptf A T 11: 107,110,860 Y475* probably null Het
Calcrl T C 2: 84,333,513 I445V probably benign Het
Ccdc110 G A 8: 45,943,400 R776Q probably benign Het
Ccnc A G 4: 21,727,894 N4S probably damaging Het
Ccni G A 5: 93,183,144 R323W probably damaging Het
Celsr2 T A 3: 108,406,987 M1241L possibly damaging Het
Cpd T C 11: 76,790,881 I1145M probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2j8 T A 4: 96,479,086 D265V probably benign Het
Dennd2a T C 6: 39,522,687 T315A probably benign Het
Dgkz T A 2: 91,936,731 Q905L probably benign Het
Dnah8 G A 17: 30,840,714 probably null Het
Elp2 A G 18: 24,619,485 H365R probably damaging Het
Gm12166 A G 11: 46,051,829 S156P probably damaging Het
Gm136 G A 4: 34,746,580 Q144* probably null Het
Gm5415 T C 1: 32,546,620 S70G probably benign Het
Gon4l T C 3: 88,908,151 V2008A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Isyna1 A T 8: 70,596,596 H414L probably damaging Het
Kif20b A G 19: 34,934,436 Y233C probably benign Het
Klk1 A T 7: 44,228,715 I132F probably damaging Het
Klre1 A T 6: 129,584,225 H183L probably benign Het
Lrp1b T C 2: 40,821,645 T3188A probably damaging Het
Mapk12 A T 15: 89,134,638 L198* probably null Het
Mt4 A C 8: 94,138,284 T29P possibly damaging Het
Myh14 C T 7: 44,661,040 V140I possibly damaging Het
Nr1h4 T C 10: 89,478,797 Q269R possibly damaging Het
Olfr1198 C G 2: 88,746,887 probably null Het
Olfr558 A G 7: 102,710,198 H313R probably benign Het
Pde1b A G 15: 103,526,685 I421V probably null Het
Pde3b A T 7: 114,508,190 T519S probably damaging Het
Phf21a T A 2: 92,357,001 C178* probably null Het
Phtf2 A G 5: 20,805,724 S88P possibly damaging Het
Pik3c3 A G 18: 30,302,929 M394V possibly damaging Het
Pp2d1 C A 17: 53,515,009 G343V probably benign Het
Ppp6r2 A G 15: 89,259,069 I140V possibly damaging Het
Ppp6r3 C A 19: 3,467,229 V75L probably damaging Het
Ptprq T A 10: 107,688,414 H486L probably benign Het
Rasgrf1 C T 9: 89,995,003 T807M probably benign Het
Rasgrp3 C A 17: 75,514,116 Y439* probably null Het
Rbm44 A G 1: 91,153,328 T413A probably benign Het
Rnf135 T C 11: 80,198,836 C333R probably damaging Het
Scfd2 A G 5: 74,519,565 V309A probably damaging Het
Serpina3m A T 12: 104,389,649 K192* probably null Het
Sh3tc2 A G 18: 61,990,435 I756V probably benign Het
Slc27a4 T C 2: 29,812,636 V516A probably damaging Het
Sult2a5 T A 7: 13,625,263 C55S probably benign Het
Tarsl2 C T 7: 65,691,294 T783M probably benign Het
Tet2 A T 3: 133,467,044 I1819N possibly damaging Het
Timeless T C 10: 128,250,762 F1057L probably damaging Het
Ttn T A 2: 76,798,074 I12835F probably damaging Het
Uhrf1 T A 17: 56,310,834 D185E probably benign Het
Vmn2r74 G T 7: 85,955,991 S483* probably null Het
Xpo1 A T 11: 23,281,327 I304F possibly damaging Het
Zc3h11a A G 1: 133,624,711 S553P probably benign Het
Zdhhc1 A G 8: 105,472,852 S402P probably benign Het
Zwilch T C 9: 64,162,746 Y101C probably damaging Het
Other mutations in Plxnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Plxnb1 APN 9 109113868 missense probably benign 0.04
IGL01014:Plxnb1 APN 9 109106034 missense probably benign 0.00
IGL01142:Plxnb1 APN 9 109102697 missense probably benign 0.05
IGL01454:Plxnb1 APN 9 109113354 missense probably damaging 1.00
IGL01469:Plxnb1 APN 9 109105415 intron probably benign
IGL01530:Plxnb1 APN 9 109110405 missense probably benign 0.02
IGL01599:Plxnb1 APN 9 109110604 missense probably damaging 1.00
IGL01968:Plxnb1 APN 9 109100984 missense probably benign 0.00
IGL02175:Plxnb1 APN 9 109100846 missense possibly damaging 0.85
IGL02216:Plxnb1 APN 9 109100850 missense probably damaging 1.00
IGL02277:Plxnb1 APN 9 109112133 missense probably damaging 1.00
IGL02311:Plxnb1 APN 9 109101122 missense probably benign
IGL02645:Plxnb1 APN 9 109114243 splice site probably benign
IGL03076:Plxnb1 APN 9 109106902 missense probably damaging 0.96
IGL03107:Plxnb1 APN 9 109104986 missense probably benign
IGL03343:Plxnb1 APN 9 109114712 missense probably damaging 1.00
R0117:Plxnb1 UTSW 9 109105218 missense possibly damaging 0.93
R0211:Plxnb1 UTSW 9 109103663 nonsense probably null
R0211:Plxnb1 UTSW 9 109103663 nonsense probably null
R0843:Plxnb1 UTSW 9 109113701 missense probably benign 0.20
R0970:Plxnb1 UTSW 9 109103263 missense probably damaging 1.00
R0973:Plxnb1 UTSW 9 109102142 missense possibly damaging 0.47
R1342:Plxnb1 UTSW 9 109100652 missense possibly damaging 0.87
R1386:Plxnb1 UTSW 9 109101023 missense probably benign 0.27
R1419:Plxnb1 UTSW 9 109114386 missense probably damaging 1.00
R1445:Plxnb1 UTSW 9 109108921 missense probably null
R1548:Plxnb1 UTSW 9 109100900 missense possibly damaging 0.95
R1621:Plxnb1 UTSW 9 109106805 missense probably benign 0.04
R1658:Plxnb1 UTSW 9 109102871 nonsense probably null
R1727:Plxnb1 UTSW 9 109101057 unclassified probably null
R1750:Plxnb1 UTSW 9 109111768 missense probably benign 0.00
R1795:Plxnb1 UTSW 9 109100745 missense probably benign
R1929:Plxnb1 UTSW 9 109102708 splice site probably null
R1935:Plxnb1 UTSW 9 109095647 critical splice donor site probably null
R1936:Plxnb1 UTSW 9 109095647 critical splice donor site probably null
R2014:Plxnb1 UTSW 9 109106619 splice site probably benign
R2057:Plxnb1 UTSW 9 109109226 missense possibly damaging 0.71
R2102:Plxnb1 UTSW 9 109115742 missense probably damaging 1.00
R2271:Plxnb1 UTSW 9 109102708 splice site probably null
R2422:Plxnb1 UTSW 9 109108438 missense probably benign 0.02
R2881:Plxnb1 UTSW 9 109114412 missense probably damaging 1.00
R3409:Plxnb1 UTSW 9 109106613 splice site probably null
R3417:Plxnb1 UTSW 9 109100760 missense probably damaging 0.97
R3756:Plxnb1 UTSW 9 109113458 unclassified probably benign
R3788:Plxnb1 UTSW 9 109109287 missense possibly damaging 0.89
R3789:Plxnb1 UTSW 9 109109287 missense possibly damaging 0.89
R4042:Plxnb1 UTSW 9 109105173 missense probably benign 0.00
R4289:Plxnb1 UTSW 9 109114352 missense probably damaging 1.00
R4396:Plxnb1 UTSW 9 109100223 missense possibly damaging 0.51
R4564:Plxnb1 UTSW 9 109113420 missense probably benign 0.10
R4676:Plxnb1 UTSW 9 109110435 missense possibly damaging 0.63
R4706:Plxnb1 UTSW 9 109112028 missense probably damaging 1.00
R4792:Plxnb1 UTSW 9 109110648 missense probably damaging 1.00
R4796:Plxnb1 UTSW 9 109114595 missense probably damaging 1.00
R4835:Plxnb1 UTSW 9 109105374 missense probably damaging 0.96
R4952:Plxnb1 UTSW 9 109114836 missense probably damaging 1.00
R5005:Plxnb1 UTSW 9 109106579 missense probably benign 0.00
R5015:Plxnb1 UTSW 9 109100430 missense possibly damaging 0.95
R5029:Plxnb1 UTSW 9 109114655 missense probably damaging 1.00
R5180:Plxnb1 UTSW 9 109111693 unclassified probably null
R5256:Plxnb1 UTSW 9 109114593 missense probably damaging 1.00
R5285:Plxnb1 UTSW 9 109108459 missense probably damaging 0.99
R5431:Plxnb1 UTSW 9 109100772 missense probably damaging 1.00
R5444:Plxnb1 UTSW 9 109106453 missense probably benign 0.22
R5546:Plxnb1 UTSW 9 109100750 missense probably damaging 1.00
R5852:Plxnb1 UTSW 9 109106450 missense probably damaging 1.00
R5892:Plxnb1 UTSW 9 109111707 missense probably damaging 1.00
R6020:Plxnb1 UTSW 9 109116611 missense probably damaging 1.00
R6053:Plxnb1 UTSW 9 109111707 missense probably damaging 1.00
R6177:Plxnb1 UTSW 9 109102925 unclassified probably null
R6193:Plxnb1 UTSW 9 109104903 missense probably benign
R6274:Plxnb1 UTSW 9 109112141 critical splice donor site probably null
R6310:Plxnb1 UTSW 9 109109728 missense probably damaging 0.96
R6404:Plxnb1 UTSW 9 109116637 missense probably damaging 1.00
R6422:Plxnb1 UTSW 9 109108924 missense probably damaging 1.00
R6479:Plxnb1 UTSW 9 109111665 missense possibly damaging 0.92
R6555:Plxnb1 UTSW 9 109108405 critical splice acceptor site probably null
R6646:Plxnb1 UTSW 9 109108827 missense probably benign
R6648:Plxnb1 UTSW 9 109104330 missense probably benign 0.14
R6661:Plxnb1 UTSW 9 109104299 missense possibly damaging 0.94
R6674:Plxnb1 UTSW 9 109108146 missense probably benign 0.00
R6734:Plxnb1 UTSW 9 109108920 nonsense probably null
R6859:Plxnb1 UTSW 9 109106770 missense probably damaging 1.00
R6948:Plxnb1 UTSW 9 109116634 missense probably damaging 0.96
R7030:Plxnb1 UTSW 9 109112307 missense probably damaging 1.00
R7038:Plxnb1 UTSW 9 109100385 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATGAACTCACCCCTTTCC -3'
(R):5'- CCTGGGAAAGTAGTGTCTGGAAC -3'

Sequencing Primer
(F):5'- GAACTCACCCCTTTCCCACCC -3'
(R):5'- GTCCAGAGCCACCATGGAAG -3'
Posted On2016-03-17