Incidental Mutation 'R4429:Scn1a'
ID328306
Institutional Source Beutler Lab
Gene Symbol Scn1a
Ensembl Gene ENSMUSG00000064329
Gene Namesodium channel, voltage-gated, type I, alpha
SynonymsNav1.1
MMRRC Submission 041699-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4429 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location66270778-66440840 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66350985 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 65 (Y65N)
Ref Sequence ENSEMBL: ENSMUSP00000116881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077489] [ENSMUST00000094951] [ENSMUST00000112366] [ENSMUST00000112371] [ENSMUST00000138910]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077489
AA Change: Y65N

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000076697
Gene: ENSMUSG00000064329
AA Change: Y65N

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.4e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 708 5.5e-73 PFAM
Pfam:Ion_trans 791 980 6.8e-47 PFAM
Pfam:Na_trans_assoc 995 1217 1.2e-74 PFAM
Pfam:Ion_trans 1243 1471 1.1e-56 PFAM
PDB:1BYY|A 1473 1525 4e-31 PDB
Pfam:Ion_trans 1564 1774 1.1e-51 PFAM
Pfam:PKD_channel 1623 1781 3.9e-7 PFAM
low complexity region 1826 1838 N/A INTRINSIC
IQ 1903 1925 1.65e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000094951
AA Change: Y65N

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000092558
Gene: ENSMUSG00000064329
AA Change: Y65N

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.3e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 691 2e-62 PFAM
Pfam:Ion_trans 774 963 6.7e-47 PFAM
Pfam:Na_trans_assoc 978 1200 1.2e-74 PFAM
Pfam:Ion_trans 1226 1454 1e-56 PFAM
PDB:1BYY|A 1456 1508 4e-31 PDB
Pfam:Ion_trans 1547 1757 1.1e-51 PFAM
Pfam:PKD_channel 1606 1764 3.8e-7 PFAM
low complexity region 1809 1821 N/A INTRINSIC
IQ 1886 1908 1.65e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112366
AA Change: Y65N

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107985
Gene: ENSMUSG00000064329
AA Change: Y65N

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 127 434 2.8e-82 PFAM
Pfam:Na_trans_cytopl 502 718 2e-91 PFAM
Pfam:Ion_trans 767 1002 6.5e-57 PFAM
Pfam:Na_trans_assoc 1006 1213 1.2e-60 PFAM
Pfam:Ion_trans 1217 1493 3.3e-67 PFAM
Pfam:Ion_trans 1540 1797 6.3e-56 PFAM
Pfam:PKD_channel 1637 1791 1.1e-6 PFAM
low complexity region 1837 1849 N/A INTRINSIC
IQ 1914 1936 1.65e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112371
AA Change: Y65N

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107990
Gene: ENSMUSG00000064329
AA Change: Y65N

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.4e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 708 5.5e-73 PFAM
Pfam:Ion_trans 791 980 6.8e-47 PFAM
Pfam:Na_trans_assoc 995 1217 1.2e-74 PFAM
Pfam:Ion_trans 1243 1471 1.1e-56 PFAM
PDB:1BYY|A 1473 1525 4e-31 PDB
Pfam:Ion_trans 1564 1774 1.1e-51 PFAM
Pfam:PKD_channel 1623 1781 3.9e-7 PFAM
low complexity region 1826 1838 N/A INTRINSIC
IQ 1903 1925 1.65e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129508
Predicted Effect possibly damaging
Transcript: ENSMUST00000138910
AA Change: Y65N

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000116881
Gene: ENSMUSG00000064329
AA Change: Y65N

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent sodium channels are heteromeric complexes that regulate sodium exchange between intracellular and extracellular spaces and are essential for the generation and propagation of action potentials in muscle cells and neurons. Each sodium channel is composed of a large pore-forming, glycosylated alpha subunit and two smaller beta subunits. This gene encodes a sodium channel alpha subunit, which has four homologous domains, each of which contains six transmembrane regions. Allelic variants of this gene are associated with generalized epilepsy with febrile seizures and epileptic encephalopathy. Alternative splicing results in multiple transcript variants. The RefSeq Project has decided to create four representative RefSeq records. Three of the transcript variants are supported by experimental evidence and the fourth contains alternate 5' untranslated exons, the exact combination of which have not been experimentally confirmed for the full-length transcript. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mice show postnatal lethality, seizures and behavioral deficits whereas heterozygotes die prematurely with seizures and abnormal electrophysiology. In addition, knock-in mice exhibit increased susceptibility to febrile and flurothyl-induced seizures, and reduced inhibitory signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abca5 T C 11: 110,311,410 T390A probably benign Het
Ahcyl2 T G 6: 29,894,875 V452G probably damaging Het
Ano4 T A 10: 88,992,942 N545I probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Catip T A 1: 74,368,732 probably benign Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cnpy3 T A 17: 46,747,144 Q111L probably benign Het
Dnah8 A G 17: 30,752,146 N2725D probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Ephb3 G A 16: 21,214,463 E66K probably damaging Het
Gm6594 T A 17: 82,539,494 D79E probably benign Het
Gtf2e2 T A 8: 33,752,493 Y74* probably null Het
Hacd4 A T 4: 88,434,947 F103I possibly damaging Het
Hap1 T C 11: 100,354,272 T38A probably benign Het
Havcr2 T A 11: 46,456,560 D72E probably damaging Het
Iqcg G A 16: 33,019,490 T362I probably benign Het
Lect2 C T 13: 56,545,725 probably null Het
Lemd3 T C 10: 120,977,988 T447A probably benign Het
Lrrc72 T C 12: 36,208,624 N78S probably damaging Het
Map3k14 A G 11: 103,227,584 L592P probably damaging Het
Meioc T C 11: 102,675,720 Y721H probably damaging Het
Mrps10 T A 17: 47,378,199 probably null Het
Myo5c A G 9: 75,294,001 Y1406C probably damaging Het
Myo7a T C 7: 98,053,188 Y2098C probably damaging Het
Nol9 C T 4: 152,041,174 T194I probably damaging Het
Nox3 G A 17: 3,682,958 T206I probably benign Het
Nsd2 T G 5: 33,843,202 M21R probably damaging Het
Pcdh9 T C 14: 93,887,384 N327S probably damaging Het
Pclo T G 5: 14,678,100 probably benign Het
Pparg T A 6: 115,440,023 M59K probably benign Het
Prag1 A G 8: 36,146,642 K1116R probably damaging Het
Rhbdf1 C T 11: 32,213,369 E368K probably benign Het
Rita1 A G 5: 120,609,561 V224A probably damaging Het
Rsph6a T A 7: 19,074,063 W384R probably damaging Het
Serpina5 C A 12: 104,103,406 F292L probably benign Het
Sf3b3 A C 8: 110,826,118 L511V probably benign Het
Siglecg C T 7: 43,417,926 P639L possibly damaging Het
Slc12a3 A T 8: 94,343,085 I541F probably damaging Het
Slco6d1 T C 1: 98,496,366 V581A possibly damaging Het
Sptbn2 T C 19: 4,738,355 Y1121H probably damaging Het
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Timm29 G C 9: 21,593,479 A148P probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Uba6 C T 5: 86,120,547 V941I probably damaging Het
Vmn1r174 T C 7: 23,754,140 V77A probably benign Het
Zfp661 A G 2: 127,578,708 V57A probably damaging Het
Zfp867 C T 11: 59,465,037 D64N possibly damaging Het
Zp3r T C 1: 130,591,391 T294A possibly damaging Het
Other mutations in Scn1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Scn1a APN 2 66335531 critical splice acceptor site probably null
IGL00650:Scn1a APN 2 66280793 missense probably damaging 1.00
IGL00658:Scn1a APN 2 66286038 missense probably damaging 1.00
IGL00823:Scn1a APN 2 66324935 missense probably benign 0.04
IGL00907:Scn1a APN 2 66327797 missense probably damaging 1.00
IGL01339:Scn1a APN 2 66325960 missense probably benign 0.09
IGL01401:Scn1a APN 2 66289111 missense probably damaging 1.00
IGL01503:Scn1a APN 2 66322343 missense probably damaging 1.00
IGL01575:Scn1a APN 2 66273236 missense probably damaging 1.00
IGL01598:Scn1a APN 2 66302485 missense possibly damaging 0.63
IGL01613:Scn1a APN 2 66285937 missense probably damaging 1.00
IGL01796:Scn1a APN 2 66332301 splice site probably benign
IGL02079:Scn1a APN 2 66323360 missense probably benign 0.14
IGL02171:Scn1a APN 2 66273199 missense probably damaging 1.00
IGL02335:Scn1a APN 2 66277661 missense possibly damaging 0.93
IGL02406:Scn1a APN 2 66326036 missense possibly damaging 0.88
IGL02436:Scn1a APN 2 66351153 missense probably benign 0.01
IGL02507:Scn1a APN 2 66277813 missense probably damaging 1.00
IGL02646:Scn1a APN 2 66299618 splice site probably null
IGL02729:Scn1a APN 2 66299650 missense probably damaging 1.00
IGL02740:Scn1a APN 2 66324762 missense probably damaging 1.00
IGL02740:Scn1a APN 2 66318077 missense probably benign 0.00
IGL02752:Scn1a APN 2 66331412 missense probably damaging 1.00
IGL02815:Scn1a APN 2 66324858 missense probably damaging 1.00
IGL03163:Scn1a APN 2 66318074 missense probably benign 0.00
IGL03229:Scn1a APN 2 66299713 missense probably damaging 1.00
IGL03286:Scn1a APN 2 66277576 missense probably damaging 0.99
IGL03393:Scn1a APN 2 66318018 missense probably benign 0.19
R0053:Scn1a UTSW 2 66299775 missense probably benign 0.05
R0053:Scn1a UTSW 2 66299775 missense probably benign 0.05
R0107:Scn1a UTSW 2 66324633 missense probably benign 0.07
R0141:Scn1a UTSW 2 66289062 missense probably damaging 1.00
R0485:Scn1a UTSW 2 66273925 missense probably damaging 0.98
R0517:Scn1a UTSW 2 66302407 missense possibly damaging 0.88
R0532:Scn1a UTSW 2 66317823 missense probably damaging 1.00
R0746:Scn1a UTSW 2 66351126 missense probably benign 0.25
R0755:Scn1a UTSW 2 66321035 missense probably damaging 1.00
R0830:Scn1a UTSW 2 66299784 missense probably damaging 1.00
R0846:Scn1a UTSW 2 66324755 missense probably benign 0.43
R0918:Scn1a UTSW 2 66323307 splice site probably null
R1055:Scn1a UTSW 2 66337996 missense probably benign 0.08
R1432:Scn1a UTSW 2 66322429 missense probably damaging 1.00
R1497:Scn1a UTSW 2 66332287 missense probably damaging 1.00
R1512:Scn1a UTSW 2 66331285 missense possibly damaging 0.82
R1525:Scn1a UTSW 2 66319462 nonsense probably null
R1567:Scn1a UTSW 2 66273331 missense probably damaging 1.00
R1702:Scn1a UTSW 2 66318223 missense probably damaging 1.00
R1744:Scn1a UTSW 2 66322276 missense probably benign 0.06
R1834:Scn1a UTSW 2 66324616 missense probably benign 0.04
R1834:Scn1a UTSW 2 66324617 missense probably benign 0.00
R1860:Scn1a UTSW 2 66317982 missense probably damaging 0.99
R1871:Scn1a UTSW 2 66318025 missense probably damaging 0.98
R1909:Scn1a UTSW 2 66331352 missense possibly damaging 0.58
R1967:Scn1a UTSW 2 66328425 missense probably damaging 1.00
R1976:Scn1a UTSW 2 66331271 missense probably benign 0.02
R2291:Scn1a UTSW 2 66288968 missense probably benign 0.44
R2302:Scn1a UTSW 2 66277745 missense probably damaging 1.00
R2367:Scn1a UTSW 2 66327679 missense probably damaging 1.00
R2418:Scn1a UTSW 2 66273843 missense probably damaging 0.98
R2517:Scn1a UTSW 2 66273832 missense probably damaging 1.00
R2568:Scn1a UTSW 2 66273469 missense probably damaging 1.00
R3083:Scn1a UTSW 2 66299637 missense probably damaging 1.00
R3903:Scn1a UTSW 2 66318132 missense probably benign 0.08
R3909:Scn1a UTSW 2 66273988 missense probably damaging 1.00
R3916:Scn1a UTSW 2 66277613 missense probably damaging 1.00
R3935:Scn1a UTSW 2 66327776 missense probably damaging 0.99
R3936:Scn1a UTSW 2 66327776 missense probably damaging 0.99
R4043:Scn1a UTSW 2 66326036 missense possibly damaging 0.60
R4495:Scn1a UTSW 2 66280802 critical splice acceptor site probably null
R4662:Scn1a UTSW 2 66350988 missense probably benign 0.23
R4834:Scn1a UTSW 2 66328522 nonsense probably null
R4873:Scn1a UTSW 2 66328476 missense possibly damaging 0.92
R4875:Scn1a UTSW 2 66328476 missense possibly damaging 0.92
R5099:Scn1a UTSW 2 66277801 missense probably damaging 1.00
R5255:Scn1a UTSW 2 66277669 missense probably damaging 0.99
R5435:Scn1a UTSW 2 66273534 missense probably damaging 1.00
R5449:Scn1a UTSW 2 66321002 missense probably damaging 0.96
R5519:Scn1a UTSW 2 66332213 missense probably damaging 1.00
R5541:Scn1a UTSW 2 66324633 missense probably benign 0.07
R5556:Scn1a UTSW 2 66324797 missense probably benign 0.00
R5587:Scn1a UTSW 2 66273081 missense probably benign 0.01
R5972:Scn1a UTSW 2 66351110 missense possibly damaging 0.65
R5992:Scn1a UTSW 2 66335456 missense probably damaging 1.00
R6195:Scn1a UTSW 2 66277618 missense possibly damaging 0.59
R6233:Scn1a UTSW 2 66277618 missense possibly damaging 0.59
R6328:Scn1a UTSW 2 66273316 missense probably damaging 1.00
R6417:Scn1a UTSW 2 66273198 missense probably damaging 1.00
R6420:Scn1a UTSW 2 66273198 missense probably damaging 1.00
R6421:Scn1a UTSW 2 66272927 missense probably damaging 1.00
R6461:Scn1a UTSW 2 66326122 missense probably null 0.01
R6701:Scn1a UTSW 2 66337960 missense probably damaging 0.99
R6717:Scn1a UTSW 2 66332287 missense probably damaging 1.00
R6834:Scn1a UTSW 2 66327742 missense probably damaging 1.00
R6918:Scn1a UTSW 2 66332213 missense probably damaging 1.00
R6953:Scn1a UTSW 2 66319469 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTGGGGCAGCTCCATATGG -3'
(R):5'- CAGGACCTGACAGCTTCAAC -3'

Sequencing Primer
(F):5'- ATCTGGTCTCATTTCTTAAGCAGAGG -3'
(R):5'- AGCTTCAACTTCTTCACCAGAG -3'
Posted On2015-07-07