Incidental Mutation 'R4994:Unc13a'
ID385105
Institutional Source Beutler Lab
Gene Symbol Unc13a
Ensembl Gene ENSMUSG00000034799
Gene Nameunc-13 homolog A (C. elegans)
Synonyms2410078G03Rik, Munc13-1
MMRRC Submission 042588-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4994 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location71624417-71671757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71643172 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1234 (I1234F)
Ref Sequence ENSEMBL: ENSMUSP00000135189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030170] [ENSMUST00000177517]
Predicted Effect probably benign
Transcript: ENSMUST00000030170
AA Change: I1234F

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000030170
Gene: ENSMUSG00000034799
AA Change: I1234F

DomainStartEndE-ValueType
C2 3 94 5.23e-10 SMART
low complexity region 187 202 N/A INTRINSIC
low complexity region 264 277 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
coiled coil region 321 359 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 435 450 N/A INTRINSIC
PDB:2KDU|B 454 488 3e-16 PDB
C1 563 612 3.93e-18 SMART
C2 686 793 5.86e-22 SMART
DUF1041 1002 1111 1.6e-56 SMART
Pfam:Membr_traf_MHD 1355 1520 6.3e-53 PFAM
C2 1555 1661 5.03e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175909
Predicted Effect unknown
Transcript: ENSMUST00000176127
AA Change: I143F
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177032
Predicted Effect probably benign
Transcript: ENSMUST00000177517
AA Change: I1234F

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135189
Gene: ENSMUSG00000034799
AA Change: I1234F

DomainStartEndE-ValueType
C2 3 94 5.23e-10 SMART
low complexity region 187 202 N/A INTRINSIC
low complexity region 264 277 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
coiled coil region 321 359 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 435 450 N/A INTRINSIC
PDB:2KDU|B 454 488 3e-16 PDB
C1 563 612 3.93e-18 SMART
C2 686 793 5.86e-22 SMART
DUF1041 1002 1111 1.6e-56 SMART
Pfam:Membr_traf_MHD 1355 1520 6.7e-53 PFAM
C2 1574 1680 5.03e-12 SMART
Meta Mutation Damage Score 0.144 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UNC13 family. UNC13 proteins bind to phorbol esters and diacylglycerol and play important roles in neurotransmitter release at synapses. Single nucleotide polymorphisms in this gene may be associated with sporadic amyotrophic lateral sclerosis. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutant mice do not feed and die within hours of birth and synaptic vesicle maturation is impaired. Mice homozygous for a knock-in allele exhibit slower rate of synaptic vesicle replenishment, aberrant short-term depression and reduced recoveryfrom synaptic depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik C A 9: 94,537,433 R148L probably benign Het
1700030K09Rik A G 8: 72,455,118 E364G probably benign Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abcb4 A G 5: 8,928,524 T557A probably damaging Het
Acadm C T 3: 153,929,584 E298K probably damaging Het
Adrb3 T C 8: 27,227,827 probably null Het
Aldh1b1 A G 4: 45,803,128 Y222C possibly damaging Het
Ankrd6 A G 4: 32,860,387 Y19H probably damaging Het
Arhgap21 T A 2: 20,849,890 T1554S probably benign Het
BC043934 T C 9: 96,437,120 noncoding transcript Het
Birc6 A G 17: 74,594,324 probably benign Het
Blm A C 7: 80,458,825 F1357C probably benign Het
Cd209a T C 8: 3,747,713 probably null Het
Cdk7 G A 13: 100,717,595 H129Y probably damaging Het
Clec14a G T 12: 58,268,284 P184Q probably damaging Het
Cma1 T A 14: 55,941,671 I243F probably damaging Het
Cntnap3 G T 13: 64,761,984 T769K possibly damaging Het
Col5a1 A C 2: 28,032,739 K273T possibly damaging Het
Csnk1e A G 15: 79,424,929 Y266H probably damaging Het
Cyb5d1 A G 11: 69,393,771 L185S probably damaging Het
Dennd5b T C 6: 149,041,500 probably null Het
Drp2 G A X: 134,441,316 R567H probably damaging Homo
Dzank1 T G 2: 144,522,566 D37A probably damaging Het
Echdc2 A G 4: 108,165,628 I34V probably benign Het
Esm1 A T 13: 113,213,431 R128S probably benign Het
Fbrsl1 A G 5: 110,447,951 S73P probably damaging Het
Fbxo18 T A 2: 11,764,230 I251F probably damaging Het
Fbxo6 A T 4: 148,149,491 S49R probably damaging Het
Gm13089 T A 4: 143,698,369 Q168L possibly damaging Het
Gm17093 A T 14: 44,519,322 Q82L probably damaging Het
Hmcn2 T C 2: 31,458,055 probably null Het
Hspa4l C A 3: 40,745,649 probably benign Het
Il3ra G A 14: 14,351,080 A201T probably benign Het
Irx5 T A 8: 92,360,781 V447E probably damaging Het
Kif14 G T 1: 136,482,959 L668F probably damaging Het
Lag3 T A 6: 124,904,453 R519W unknown Het
Lgr4 A G 2: 110,011,938 N756S probably damaging Het
Lingo4 A G 3: 94,402,541 H262R probably benign Het
Lingo4 T A 3: 94,403,001 H415Q probably benign Het
Lkaaear1 C A 2: 181,697,583 G25* probably null Het
Marf1 T C 16: 14,114,231 K1641E probably benign Het
Mtfmt T C 9: 65,443,851 probably benign Het
Mtif3 G A 5: 146,956,788 T203M probably benign Het
Mycbp2 A G 14: 103,169,994 I2740T probably benign Het
Nrd1 A G 4: 109,046,612 T720A probably benign Het
Olfr715 T C 7: 107,129,064 T110A probably benign Het
Peak1 T A 9: 56,241,276 D32V possibly damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Plekhg3 A G 12: 76,565,537 R391G possibly damaging Het
Ppfia3 T C 7: 45,341,118 D919G probably damaging Het
Rnase2b T A 14: 51,162,751 D96E possibly damaging Het
Rsf1 CGGCGGC CGGCGGCCGCGGCGGC 7: 97,579,923 probably benign Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Serpina3f A G 12: 104,220,356 T394A probably benign Het
Six3 A G 17: 85,621,292 N18S possibly damaging Het
Slc12a5 T A 2: 164,983,365 probably null Het
Slc35f6 A G 5: 30,648,083 N21S probably damaging Het
Slc39a6 A T 18: 24,596,294 I454N probably damaging Het
Slc40a1 T A 1: 45,909,664 E485D probably damaging Het
Sort1 G A 3: 108,328,069 C255Y probably damaging Het
Stab2 T A 10: 86,949,907 T624S probably benign Het
Stk33 T A 7: 109,340,398 I99L probably benign Het
Taf4b T A 18: 14,898,043 I828N probably damaging Het
Terf2 T C 8: 107,076,478 probably benign Het
Timd4 C T 11: 46,815,517 R49C probably damaging Het
Tmem57 A G 4: 134,828,299 Y288H probably damaging Het
Tpte T C 8: 22,318,346 S166P probably benign Het
Trabd2b T C 4: 114,406,855 L13P probably benign Het
Trappc11 A T 8: 47,522,441 Y247* probably null Het
Trnt1 C T 6: 106,778,892 Q303* probably null Het
Tspyl5 T A 15: 33,687,055 Q248L possibly damaging Het
Ubxn7 A T 16: 32,381,504 K337N probably damaging Het
Vmn1r127 A T 7: 21,319,018 F282I probably damaging Het
Wdhd1 A T 14: 47,268,654 probably null Het
Zfp605 A G 5: 110,127,486 K157E probably damaging Het
Zhx2 T A 15: 57,821,359 D41E probably benign Het
Other mutations in Unc13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Unc13a APN 8 71643147 missense probably null 0.70
IGL01023:Unc13a APN 8 71661825 missense probably benign 0.02
IGL01456:Unc13a APN 8 71644567 missense probably damaging 1.00
IGL01820:Unc13a APN 8 71654947 missense probably damaging 0.99
IGL01909:Unc13a APN 8 71639210 splice site probably benign
IGL01925:Unc13a APN 8 71634543 missense possibly damaging 0.95
IGL02407:Unc13a APN 8 71648942 missense probably damaging 0.99
IGL02622:Unc13a APN 8 71652514 splice site probably null
IGL02634:Unc13a APN 8 71655701 missense probably benign 0.03
IGL02724:Unc13a APN 8 71656305 splice site probably benign
IGL02892:Unc13a APN 8 71649910 missense probably damaging 1.00
IGL02948:Unc13a APN 8 71650549 missense possibly damaging 0.63
IGL03081:Unc13a APN 8 71649549 missense probably damaging 0.98
IGL03372:Unc13a APN 8 71655709 missense probably damaging 1.00
curvy UTSW 8 71630504 splice site probably null
greed UTSW 8 71654845 missense probably damaging 1.00
largesse UTSW 8 71634658 missense probably damaging 1.00
serpiginous UTSW 8 71664245 missense probably damaging 1.00
PIT4469001:Unc13a UTSW 8 71658314 nonsense probably null
R0067:Unc13a UTSW 8 71634658 missense probably damaging 1.00
R0067:Unc13a UTSW 8 71634658 missense probably damaging 1.00
R0389:Unc13a UTSW 8 71658032 missense probably benign 0.01
R0457:Unc13a UTSW 8 71658001 critical splice donor site probably null
R0478:Unc13a UTSW 8 71651148 missense possibly damaging 0.92
R0483:Unc13a UTSW 8 71644913 missense probably damaging 0.96
R0609:Unc13a UTSW 8 71658467 missense probably damaging 0.96
R0611:Unc13a UTSW 8 71649865 missense probably damaging 1.00
R0730:Unc13a UTSW 8 71656285 missense possibly damaging 0.68
R0883:Unc13a UTSW 8 71642173 nonsense probably null
R1162:Unc13a UTSW 8 71647917 missense probably benign 0.31
R1185:Unc13a UTSW 8 71661833 missense probably benign 0.13
R1185:Unc13a UTSW 8 71661833 missense probably benign 0.13
R1185:Unc13a UTSW 8 71661833 missense probably benign 0.13
R1196:Unc13a UTSW 8 71654986 missense probably damaging 1.00
R1400:Unc13a UTSW 8 71651221 missense probably damaging 1.00
R1446:Unc13a UTSW 8 71648981 missense possibly damaging 0.91
R1507:Unc13a UTSW 8 71658266 missense probably benign
R1636:Unc13a UTSW 8 71653390 missense probably damaging 1.00
R1858:Unc13a UTSW 8 71652399 missense probably damaging 1.00
R2025:Unc13a UTSW 8 71639768 missense possibly damaging 0.92
R2107:Unc13a UTSW 8 71656251 splice site probably null
R2286:Unc13a UTSW 8 71630559 missense probably damaging 1.00
R2334:Unc13a UTSW 8 71634558 missense probably damaging 1.00
R2924:Unc13a UTSW 8 71644952 missense possibly damaging 0.88
R3177:Unc13a UTSW 8 71629695 missense probably benign 0.01
R3277:Unc13a UTSW 8 71629695 missense probably benign 0.01
R4175:Unc13a UTSW 8 71667724 intron probably benign
R4279:Unc13a UTSW 8 71666667 missense probably damaging 0.98
R4629:Unc13a UTSW 8 71653453 missense possibly damaging 0.65
R4803:Unc13a UTSW 8 71662850 splice site probably null
R4877:Unc13a UTSW 8 71658616 missense possibly damaging 0.85
R4927:Unc13a UTSW 8 71654845 missense probably damaging 1.00
R4930:Unc13a UTSW 8 71630504 splice site probably null
R5011:Unc13a UTSW 8 71641477 nonsense probably null
R5252:Unc13a UTSW 8 71652564 missense probably damaging 1.00
R5356:Unc13a UTSW 8 71662514 missense probably benign 0.02
R5458:Unc13a UTSW 8 71664245 missense probably damaging 1.00
R5514:Unc13a UTSW 8 71643151 missense probably damaging 1.00
R5784:Unc13a UTSW 8 71655666 missense possibly damaging 0.61
R5853:Unc13a UTSW 8 71655129 splice site probably null
R6183:Unc13a UTSW 8 71644666 missense probably damaging 1.00
R6277:Unc13a UTSW 8 71666639 critical splice donor site probably null
R6374:Unc13a UTSW 8 71641453 missense possibly damaging 0.70
R6392:Unc13a UTSW 8 71637809 missense possibly damaging 0.83
R6515:Unc13a UTSW 8 71647940 missense probably benign 0.44
R6576:Unc13a UTSW 8 71653478 missense probably benign 0.00
R6943:Unc13a UTSW 8 71652377 missense probably damaging 1.00
R7045:Unc13a UTSW 8 71658763 missense possibly damaging 0.95
R7062:Unc13a UTSW 8 71663237 missense probably benign 0.00
R7146:Unc13a UTSW 8 71630553 missense probably damaging 1.00
R7260:Unc13a UTSW 8 71660585 missense possibly damaging 0.71
R7443:Unc13a UTSW 8 71630959 missense probably damaging 0.98
Z1088:Unc13a UTSW 8 71654803 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGATTCATGTCCCTTCAGTGG -3'
(R):5'- GAAAGCAATACTTCCATGGGGC -3'

Sequencing Primer
(F):5'- TCAAGTCTCATGTCAGAGCCTGG -3'
(R):5'- TTCCATGGGGCGGGGTC -3'
Posted On2016-05-10