Incidental Mutation 'R4998:Npepps'
ID389662
Institutional Source Beutler Lab
Gene Symbol Npepps
Ensembl Gene ENSMUSG00000001441
Gene Nameaminopeptidase puromycin sensitive
SynonymsMP100, Psa
MMRRC Submission 042592-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.761) question?
Stock #R4998 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location97205842-97280638 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 97206107 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001480] [ENSMUST00000167806] [ENSMUST00000172108]
Predicted Effect probably benign
Transcript: ENSMUST00000001480
SMART Domains Protein: ENSMUSP00000001480
Gene: ENSMUSG00000001441

DomainStartEndE-ValueType
low complexity region 3 45 N/A INTRINSIC
Pfam:Peptidase_M1 54 442 5.2e-155 PFAM
Pfam:ERAP1_C 579 892 7.9e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107608
Predicted Effect probably benign
Transcript: ENSMUST00000165216
SMART Domains Protein: ENSMUSP00000128169
Gene: ENSMUSG00000001441

DomainStartEndE-ValueType
low complexity region 4 35 N/A INTRINSIC
Pfam:Peptidase_M1 46 183 1.6e-28 PFAM
Pfam:Peptidase_M1 174 398 2.9e-100 PFAM
Pfam:ERAP1_C 535 848 2.9e-71 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165489
Predicted Effect unknown
Transcript: ENSMUST00000167806
AA Change: C672R
SMART Domains Protein: ENSMUSP00000130445
Gene: ENSMUSG00000001441
AA Change: C672R

DomainStartEndE-ValueType
low complexity region 3 45 N/A INTRINSIC
Pfam:Peptidase_M1 54 442 3e-153 PFAM
Pfam:Peptidase_MA_2 321 465 7.4e-24 PFAM
Pfam:ERAP1_C 579 632 5.6e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171320
Predicted Effect probably benign
Transcript: ENSMUST00000172108
SMART Domains Protein: ENSMUSP00000127801
Gene: ENSMUSG00000001441

DomainStartEndE-ValueType
low complexity region 3 45 N/A INTRINSIC
Pfam:Peptidase_M1 54 442 6e-153 PFAM
Pfam:Peptidase_MA_2 321 465 1.2e-23 PFAM
Pfam:ERAP1_C 579 859 5.7e-55 PFAM
low complexity region 868 886 N/A INTRINSIC
Meta Mutation Damage Score 0.0676 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 97% (91/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the puromycin-sensitive aminopeptidase, a zinc metallopeptidase which hydrolyzes amino acids from the N-terminus of its substrate. The protein has been localized to both the cytoplasm and to cellular membranes. This enzyme degrades enkaphalins in the brain, and studies in mouse suggest that it is involved in proteolytic events regulating the cell cycle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a gene-trapped mutation exhibit dwarfism, increased anxiety, decreased pain sensitivity, and infertility in both sexes. Females fail to produce the corpus luteum of pregnancy, while males fail to copulate and have impaired spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T C 7: 27,571,663 V135A probably damaging Het
Ankrd42 T C 7: 92,624,074 N115S possibly damaging Het
Baz1a T C 12: 54,975,137 E120G probably damaging Het
Calcrl A T 2: 84,339,314 V341E probably damaging Het
Card6 T C 15: 5,100,082 R611G probably benign Het
Cd70 A T 17: 57,146,311 S118T probably damaging Het
Chil5 T A 3: 106,019,932 I188F probably damaging Het
Clca4b C T 3: 144,915,508 V602I probably benign Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Col6a4 A G 9: 105,990,778 probably benign Het
Cox8b T C 7: 140,899,088 E38G probably damaging Het
Cx3cl1 C G 8: 94,780,425 L353V probably damaging Het
Cyp2a4 G T 7: 26,307,361 Q48H probably damaging Het
Defb8 T C 8: 19,447,587 I3V probably benign Het
Dip2a A T 10: 76,319,556 L65* probably null Het
Dsg2 A T 18: 20,601,521 D852V probably benign Het
Dyx1c1 A G 9: 72,960,678 T74A possibly damaging Het
Edar T C 10: 58,606,093 R326G probably damaging Het
Egfr A G 11: 16,881,493 E554G possibly damaging Het
Eif2b3 A C 4: 117,066,392 K268T probably benign Het
Enox1 A T 14: 77,501,435 probably benign Het
Enpp3 C A 10: 24,807,538 M260I probably benign Het
Espn A T 4: 152,135,583 M361K possibly damaging Het
Fam107a T C 14: 8,299,514 N108S possibly damaging Het
Fam57b C T 7: 126,827,623 R73C probably damaging Het
Fbn2 A T 18: 58,072,631 V1125D probably damaging Het
Fbxo30 T A 10: 11,290,763 S410T probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fuk G A 8: 110,887,803 A618V probably damaging Het
Gm10715 T G 9: 3,038,073 probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm17416 C A 2: 152,569,507 P57Q probably damaging Het
Gm27013 A T 6: 130,676,538 C654S probably damaging Het
Gm9495 G C 8: 69,453,358 N13K probably benign Het
Gon4l G T 3: 88,899,998 E1666D probably damaging Het
Gypa T A 8: 80,496,335 S23T unknown Het
Gys1 C A 7: 45,451,544 probably benign Het
Hdac10 T A 15: 89,123,940 Q569L possibly damaging Het
Icos A G 1: 60,993,782 T47A possibly damaging Het
Igfn1 T A 1: 135,954,666 I2814F probably damaging Het
Kif27 A G 13: 58,293,143 S1153P probably damaging Het
Lin28a A C 4: 134,018,717 F9V possibly damaging Het
Lrriq3 T A 3: 155,188,058 N465K probably benign Het
Lsm14a T C 7: 34,375,374 E47G probably damaging Het
Mmel1 A G 4: 154,885,510 K177R probably benign Het
Ncstn T A 1: 172,071,520 N348I possibly damaging Het
Ninl A G 2: 150,953,364 I619T probably damaging Het
Npb T C 11: 120,608,575 Y23H probably damaging Het
Olfr1076 T C 2: 86,509,355 Y299H probably benign Het
Otop1 G A 5: 38,294,548 probably null Het
Pcdha1 T C 18: 36,932,416 L711P probably damaging Het
Pcyt1a A G 16: 32,451,842 probably benign Het
Pdpr G T 8: 111,114,768 V211F probably damaging Het
Pip4k2b T C 11: 97,722,435 N245S possibly damaging Het
Platr26 G A 2: 71,730,870 noncoding transcript Het
Plek A G 11: 16,983,194 probably null Het
Prdm15 A T 16: 97,794,489 D1046E probably damaging Het
Prr29 T G 11: 106,376,953 C175G probably benign Het
Ptpru A G 4: 131,776,885 V1097A probably damaging Het
Ramp2 T A 11: 101,247,421 probably benign Het
Rap1gap A G 4: 137,728,284 D381G possibly damaging Het
Rbbp6 T A 7: 122,990,326 D412E probably benign Het
Rgs4 C T 1: 169,745,233 V45I probably benign Het
Ryr2 C T 13: 11,643,895 R3614Q probably damaging Het
Shc3 G A 13: 51,442,820 probably null Het
Shmt2 A T 10: 127,518,270 C412S probably damaging Het
Slc25a45 A T 19: 5,884,917 N265Y probably damaging Het
Slc4a10 G C 2: 62,244,439 E316Q probably benign Het
Slc5a8 T C 10: 88,908,057 probably null Het
Snx31 A G 15: 36,539,367 V121A probably damaging Het
Socs3 T C 11: 117,967,716 E172G probably damaging Het
Tg A G 15: 66,674,050 D207G probably damaging Het
Them4 G T 3: 94,329,781 V183F probably damaging Het
Tkt G A 14: 30,565,542 W136* probably null Het
Tmc3 C A 7: 83,622,321 R894S probably benign Het
Tmem132a G T 19: 10,858,941 P742T probably benign Het
Tmem202 A G 9: 59,524,846 L66P probably damaging Het
Trbc1 G A 6: 41,539,336 probably benign Het
Trhr2 A G 8: 122,358,772 F158L probably benign Het
Ttc13 A T 8: 124,680,056 N595K probably damaging Het
Ucp1 A G 8: 83,297,855 probably null Het
Zbtb4 C T 11: 69,778,671 T740I probably benign Het
Zfp69 A T 4: 120,947,325 D116E possibly damaging Het
Zfp879 A G 11: 50,837,969 L66S probably damaging Het
Zfp955b T A 17: 33,305,151 probably benign Het
Zfyve1 T C 12: 83,548,065 I718V possibly damaging Het
Other mutations in Npepps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00826:Npepps APN 11 97236058 splice site probably benign
IGL00904:Npepps APN 11 97258306 missense probably damaging 0.99
IGL00925:Npepps APN 11 97280283 missense probably damaging 0.97
IGL01074:Npepps APN 11 97217811 missense probably damaging 0.98
IGL01869:Npepps APN 11 97236122 missense probably damaging 1.00
IGL01879:Npepps APN 11 97258340 missense possibly damaging 0.66
IGL02145:Npepps APN 11 97218502 splice site probably null
IGL02493:Npepps APN 11 97238159 missense probably damaging 1.00
IGL02561:Npepps APN 11 97229849 nonsense probably null
IGL02957:Npepps APN 11 97242652 missense probably damaging 1.00
IGL03008:Npepps APN 11 97238158 missense probably damaging 1.00
IGL03054:Npepps UTSW 11 97241788 intron probably benign
R0280:Npepps UTSW 11 97241014 missense possibly damaging 0.90
R0743:Npepps UTSW 11 97206058 utr 3 prime probably benign
R0838:Npepps UTSW 11 97267692 splice site probably benign
R1449:Npepps UTSW 11 97207154 missense probably benign 0.01
R1478:Npepps UTSW 11 97226847 missense probably benign 0.03
R1502:Npepps UTSW 11 97218575 missense possibly damaging 0.79
R1726:Npepps UTSW 11 97224669 missense probably damaging 1.00
R2413:Npepps UTSW 11 97240966 missense probably damaging 1.00
R3619:Npepps UTSW 11 97248265 missense possibly damaging 0.90
R4620:Npepps UTSW 11 97238244 missense probably damaging 1.00
R4782:Npepps UTSW 11 97226826 missense probably damaging 1.00
R4810:Npepps UTSW 11 97240933 missense probably damaging 1.00
R5086:Npepps UTSW 11 97217799 missense probably benign 0.01
R5289:Npepps UTSW 11 97240927 critical splice donor site probably null
R5740:Npepps UTSW 11 97236068 missense possibly damaging 0.85
R6004:Npepps UTSW 11 97223124 missense probably benign 0.03
R6181:Npepps UTSW 11 97242004 missense probably damaging 0.98
R6213:Npepps UTSW 11 97241997 nonsense probably null
R6244:Npepps UTSW 11 97213790 missense probably damaging 1.00
R6318:Npepps UTSW 11 97218548 missense probably damaging 0.98
R6478:Npepps UTSW 11 97258273 critical splice donor site probably null
R6724:Npepps UTSW 11 97206002 utr 3 prime probably benign
R6890:Npepps UTSW 11 97267644 nonsense probably null
R7035:Npepps UTSW 11 97223139 missense probably damaging 0.99
X0021:Npepps UTSW 11 97238120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGAAGCAGTCTCACAATCTG -3'
(R):5'- AAGGAACCCTGACATGCATAAG -3'

Sequencing Primer
(F):5'- GGAAGCAGTCTCACAATCTGATGAC -3'
(R):5'- CCCTGACATGCATAAGAGGTG -3'
Posted On2016-06-06