Incidental Mutation 'R5321:Vmn1r24'
ID406107
Institutional Source Beutler Lab
Gene Symbol Vmn1r24
Ensembl Gene ENSMUSG00000115507
Gene Namevomeronasal 1 receptor 24
SynonymsV1rc18
MMRRC Submission 042904-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.354) question?
Stock #R5321 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location57954707-57961503 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 57956197 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 112 (L112*)
Ref Sequence ENSEMBL: ENSMUSP00000153775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000175716] [ENSMUST00000228097] [ENSMUST00000228315]
Predicted Effect probably null
Transcript: ENSMUST00000175716
AA Change: L112*
SMART Domains Protein: ENSMUSP00000134939
Gene: ENSMUSG00000093451
AA Change: L112*

DomainStartEndE-ValueType
Pfam:V1R 29 293 8.2e-55 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000228097
AA Change: L112*
Predicted Effect probably null
Transcript: ENSMUST00000228315
AA Change: L112*
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,327,825 F72L probably benign Het
Btrc G A 19: 45,507,758 V211M probably damaging Het
Col6a5 A T 9: 105,928,465 Y1081N unknown Het
Cryzl1 T C 16: 91,707,230 Y109C probably benign Het
Dlec1 T A 9: 119,112,601 S352T probably benign Het
Dzip3 T G 16: 48,957,675 T349P possibly damaging Het
Endou A G 15: 97,721,032 V37A probably damaging Het
Exosc1 A T 19: 41,924,060 C129* probably null Het
Flywch1 C G 17: 23,756,651 R539P probably damaging Het
Gm14410 G A 2: 177,193,505 T322I probably damaging Het
Gm340 G T 19: 41,585,204 W799C probably damaging Het
Lpin2 G A 17: 71,246,858 V857M probably damaging Het
Olfr629 T C 7: 103,740,655 N195S probably damaging Het
Patl1 A G 19: 11,921,421 Q160R probably damaging Het
Phtf1 C T 3: 104,003,511 T606I probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Scrt1 T C 15: 76,519,170 S207G unknown Het
Slc15a5 G T 6: 137,987,438 N496K probably benign Het
Slc17a2 A T 13: 23,812,631 I40F possibly damaging Het
Tdrd12 A C 7: 35,478,094 V945G probably damaging Het
Tdrkh C A 3: 94,425,658 L169I probably damaging Het
Tmem59l A G 8: 70,487,215 C35R probably damaging Het
Tpte A T 8: 22,297,203 R33* probably null Het
Trpv2 T A 11: 62,584,571 L270H probably damaging Het
Utp18 A G 11: 93,866,434 L468P probably damaging Het
Uxs1 A G 1: 43,805,645 I51T probably damaging Het
Vmn1r20 C T 6: 57,432,442 S251L probably benign Het
Vmn1r5 T C 6: 56,985,607 L89P probably damaging Het
Vmn2r10 G T 5: 108,995,639 A815E probably damaging Het
Zfp119a A T 17: 55,865,595 L416H probably damaging Het
Other mutations in Vmn1r24
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0064:Vmn1r24 UTSW 6 57956018 missense probably benign 0.03
R1707:Vmn1r24 UTSW 6 57956512 missense probably benign 0.02
R2079:Vmn1r24 UTSW 6 57955670 missense probably benign 0.10
R4867:Vmn1r24 UTSW 6 57956436 missense probably damaging 0.96
R6954:Vmn1r24 UTSW 6 57956452 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTCATGGGAAAGTGTGAGC -3'
(R):5'- CTAAGCCTGTGGACCTGATCTC -3'

Sequencing Primer
(F):5'- GCAGTAATTAGTGACCTTCATCTGGC -3'
(R):5'- CACATAATTATGGTCCTCACTGGATG -3'
Posted On2016-07-22