Incidental Mutation 'R5321:Gm340'
ID406129
Institutional Source Beutler Lab
Gene Symbol Gm340
Ensembl Gene ENSMUSG00000090673
Gene Namepredicted gene 340
SynonymsLOC381224
MMRRC Submission 042904-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R5321 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location41582370-41586536 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 41585204 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Cysteine at position 799 (W799C)
Ref Sequence ENSEMBL: ENSMUSP00000128083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172371]
Predicted Effect probably damaging
Transcript: ENSMUST00000172371
AA Change: W799C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128083
Gene: ENSMUSG00000090673
AA Change: W799C

DomainStartEndE-ValueType
low complexity region 10 17 N/A INTRINSIC
low complexity region 438 450 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
low complexity region 768 779 N/A INTRINSIC
Pfam:DUF4553 787 1241 9.7e-179 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183602
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,327,825 F72L probably benign Het
Btrc G A 19: 45,507,758 V211M probably damaging Het
Col6a5 A T 9: 105,928,465 Y1081N unknown Het
Cryzl1 T C 16: 91,707,230 Y109C probably benign Het
Dlec1 T A 9: 119,112,601 S352T probably benign Het
Dzip3 T G 16: 48,957,675 T349P possibly damaging Het
Endou A G 15: 97,721,032 V37A probably damaging Het
Exosc1 A T 19: 41,924,060 C129* probably null Het
Flywch1 C G 17: 23,756,651 R539P probably damaging Het
Gm14410 G A 2: 177,193,505 T322I probably damaging Het
Lpin2 G A 17: 71,246,858 V857M probably damaging Het
Olfr629 T C 7: 103,740,655 N195S probably damaging Het
Patl1 A G 19: 11,921,421 Q160R probably damaging Het
Phtf1 C T 3: 104,003,511 T606I probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Scrt1 T C 15: 76,519,170 S207G unknown Het
Slc15a5 G T 6: 137,987,438 N496K probably benign Het
Slc17a2 A T 13: 23,812,631 I40F possibly damaging Het
Tdrd12 A C 7: 35,478,094 V945G probably damaging Het
Tdrkh C A 3: 94,425,658 L169I probably damaging Het
Tmem59l A G 8: 70,487,215 C35R probably damaging Het
Tpte A T 8: 22,297,203 R33* probably null Het
Trpv2 T A 11: 62,584,571 L270H probably damaging Het
Utp18 A G 11: 93,866,434 L468P probably damaging Het
Uxs1 A G 1: 43,805,645 I51T probably damaging Het
Vmn1r20 C T 6: 57,432,442 S251L probably benign Het
Vmn1r24 A T 6: 57,956,197 L112* probably null Het
Vmn1r5 T C 6: 56,985,607 L89P probably damaging Het
Vmn2r10 G T 5: 108,995,639 A815E probably damaging Het
Zfp119a A T 17: 55,865,595 L416H probably damaging Het
Other mutations in Gm340
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0006:Gm340 UTSW 19 41584899 missense probably benign 0.00
R0686:Gm340 UTSW 19 41582372 missense possibly damaging 0.73
R1104:Gm340 UTSW 19 41586063 missense probably damaging 0.99
R1278:Gm340 UTSW 19 41584683 missense probably benign 0.07
R1606:Gm340 UTSW 19 41585074 missense probably benign 0.35
R1833:Gm340 UTSW 19 41584948 missense probably benign 0.00
R1905:Gm340 UTSW 19 41583574 missense possibly damaging 0.73
R2697:Gm340 UTSW 19 41584027 missense probably benign 0.43
R2881:Gm340 UTSW 19 41583049 missense probably damaging 1.00
R4720:Gm340 UTSW 19 41585895 missense probably benign 0.04
R4864:Gm340 UTSW 19 41585364 missense probably benign
R4908:Gm340 UTSW 19 41584162 missense probably benign 0.00
R5193:Gm340 UTSW 19 41582530 missense probably damaging 1.00
R5215:Gm340 UTSW 19 41585932 missense probably damaging 1.00
R5276:Gm340 UTSW 19 41585039 missense probably damaging 0.98
R5319:Gm340 UTSW 19 41586352 missense probably damaging 0.99
R5432:Gm340 UTSW 19 41584603 missense probably damaging 1.00
R5605:Gm340 UTSW 19 41582863 missense probably damaging 1.00
R5941:Gm340 UTSW 19 41586400 missense probably damaging 1.00
R6020:Gm340 UTSW 19 41583547 missense possibly damaging 0.88
R6024:Gm340 UTSW 19 41583957 missense possibly damaging 0.84
R6149:Gm340 UTSW 19 41585202 missense probably damaging 1.00
R6260:Gm340 UTSW 19 41582370 missense probably null 0.91
R6260:Gm340 UTSW 19 41582371 missense possibly damaging 0.73
R6476:Gm340 UTSW 19 41583079 missense probably benign 0.04
R7051:Gm340 UTSW 19 41585752 missense probably benign 0.05
R7285:Gm340 UTSW 19 41584315 missense possibly damaging 0.91
R7372:Gm340 UTSW 19 41585506 missense probably damaging 1.00
X0013:Gm340 UTSW 19 41584532 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCCTAAGAGACTGCCTTCTTC -3'
(R):5'- GAAAACTTTTGCACCTCCAACG -3'

Sequencing Primer
(F):5'- TCTTCTACCTACAACCTGAGACATG -3'
(R):5'- GACCCCCTACACTTCCGTG -3'
Posted On2016-07-22