Incidental Mutation 'R0066:Rfx2'
Institutional Source Beutler Lab
Gene Symbol Rfx2
Ensembl Gene ENSMUSG00000024206
Gene Nameregulatory factor X, 2 (influences HLA class II expression)
MMRRC Submission 038357-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.832) question?
Stock #R0066 (G1)
Quality Score225
Status Validated
Chromosomal Location56775897-56831008 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 56786736 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000084010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002444] [ENSMUST00000086801]
Predicted Effect probably benign
Transcript: ENSMUST00000002444
SMART Domains Protein: ENSMUSP00000002444
Gene: ENSMUSG00000024206

Pfam:RFX1_trans_act 4 149 1.9e-50 PFAM
Pfam:RFX_DNA_binding 192 269 4.3e-36 PFAM
Blast:HisKA 479 542 1e-31 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000086801
SMART Domains Protein: ENSMUSP00000084010
Gene: ENSMUSG00000024206

Pfam:RFX1_trans_act 1 151 6.8e-56 PFAM
Pfam:RFX_DNA_binding 161 246 6e-41 PFAM
Blast:HisKA 454 517 1e-31 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.0%
Validation Efficiency 100% (107/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X3, X4, and X5. It is a transcriptional activator that can bind DNA as a monomer or as a heterodimer with other RFX family members. This protein can bind to cis elements in the promoter of the IL-5 receptor alpha gene. Two transcript variants encoding different isoforms have been described for this gene, and both variants utilize alternative polyadenylation sites. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and lack an obvious embryonic phenotype but exhibit male infertility associated with a defect in spermatid maturation at or before the round and elongating spermatid stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik A G 9: 22,207,881 noncoding transcript Het
5530400C23Rik A T 6: 133,292,324 probably benign Het
Aco2 T C 15: 81,903,465 probably benign Het
Arap3 A T 18: 37,996,707 S134T probably benign Het
Arsa T A 15: 89,474,336 M288L possibly damaging Het
Atg2b A T 12: 105,648,449 D1074E probably benign Het
Baiap2l1 A T 5: 144,284,562 I174N probably damaging Het
Bpifb9a A T 2: 154,266,841 N421Y possibly damaging Het
Btn2a2 T A 13: 23,478,485 I432L probably benign Het
Ccdc150 A G 1: 54,356,691 I778V probably benign Het
Cd200r2 G A 16: 44,909,674 V194I possibly damaging Het
Cep350 A C 1: 155,911,218 L1421R probably damaging Het
Col24a1 G A 3: 145,545,144 A1633T probably damaging Het
Col6a6 A T 9: 105,702,213 C1938S probably damaging Het
Cspg4 A T 9: 56,888,134 D1051V probably damaging Het
Cstf1 T A 2: 172,373,056 N32K probably benign Het
Ctrb1 G A 8: 111,686,637 R248* probably null Het
Cyp2d11 T A 15: 82,391,757 M208L probably benign Het
Dbt A G 3: 116,543,829 Q334R probably benign Het
Dcaf12 A G 4: 41,298,338 V270A probably damaging Het
Dis3l T A 9: 64,319,165 N361I probably benign Het
Dnah10 A T 5: 124,763,076 D1315V probably benign Het
Dnah11 A G 12: 118,126,886 F1080S probably benign Het
Dnm3 A G 1: 162,407,361 V70A probably damaging Het
Dpy19l1 A C 9: 24,414,409 M700R possibly damaging Het
Dpy19l2 G A 9: 24,646,383 probably benign Het
Dst C A 1: 34,189,553 H2254N possibly damaging Het
Epm2aip1 A G 9: 111,272,463 N168S probably benign Het
Fchsd2 A G 7: 101,278,424 Y691C possibly damaging Het
Fndc8 A T 11: 82,897,572 D76V probably benign Het
Frmd4a T C 2: 4,473,152 L48P probably damaging Het
Gimap6 T A 6: 48,702,470 I211F probably damaging Het
Gm15130 A G 2: 111,138,939 probably benign Het
Gm43302 T A 5: 105,290,900 I41F probably damaging Het
Gm5698 C T 1: 30,977,533 V146I probably benign Het
Gpatch1 G A 7: 35,287,227 S768L probably damaging Het
Grb14 T G 2: 64,938,492 probably null Het
Hnrnpd T C 5: 99,964,701 E222G probably damaging Het
Il4ra C T 7: 125,576,231 P537L possibly damaging Het
Kalrn T C 16: 34,203,957 D610G probably damaging Het
Kcnh4 T C 11: 100,757,800 H26R probably benign Het
Kctd2 T G 11: 115,429,517 probably benign Het
Khdrbs3 T A 15: 68,995,037 probably benign Het
Macf1 G A 4: 123,432,150 Q3066* probably null Het
Mfn2 G A 4: 147,885,445 probably benign Het
Mmab T C 5: 114,436,465 probably benign Het
Mrc1 T C 2: 14,261,200 S310P probably benign Het
Mrps21 T C 3: 95,862,885 Y44C probably null Het
Myh10 T A 11: 68,699,491 F121Y probably damaging Het
Myo1f A G 17: 33,601,703 D840G probably damaging Het
Neb T A 2: 52,306,530 D553V probably damaging Het
Nol6 G T 4: 41,119,572 probably benign Het
Npr2 G T 4: 43,632,329 V49L probably benign Het
Ntsr2 T C 12: 16,654,119 I207T probably benign Het
Nwd1 T A 8: 72,711,856 S1552T probably benign Het
Oas3 T A 5: 120,758,875 I894F probably damaging Het
Olfr169 T A 16: 19,566,049 Y278F probably damaging Het
Olfr456 A T 6: 42,486,935 M86K probably benign Het
Olfr736 T A 14: 50,393,202 F149I probably benign Het
Olfr983 T C 9: 40,092,687 N93S possibly damaging Het
Oprd1 A G 4: 132,113,988 F220L probably benign Het
Pkd1l3 G T 8: 109,620,471 G159C unknown Het
Plcb4 T C 2: 135,961,769 S521P probably benign Het
Plcl1 A T 1: 55,713,475 I993F probably damaging Het
Plcxd1 T A 5: 110,101,502 V65E probably damaging Het
Plekha7 T C 7: 116,157,508 S640G probably damaging Het
Ptprn2 A C 12: 117,276,602 N993T probably benign Het
Rabepk T C 2: 34,795,306 D26G possibly damaging Het
Reck A G 4: 43,930,936 N646D probably damaging Het
Ripk2 G A 4: 16,123,868 Q436* probably null Het
Ryr1 C T 7: 29,005,567 probably benign Het
Sema6b A G 17: 56,128,271 V324A possibly damaging Het
Sik2 C A 9: 50,998,533 M73I probably benign Het
Slc39a6 T C 18: 24,599,269 K321E probably damaging Het
Slc7a4 C A 16: 17,574,011 V520F probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Spink14 T C 18: 44,028,763 V2A probably benign Het
Sptan1 C A 2: 30,003,667 probably benign Het
Stab1 C T 14: 31,157,070 probably benign Het
Tbc1d17 C T 7: 44,844,071 probably benign Het
Tbcd T A 11: 121,503,764 L49* probably null Het
Tmco6 A G 18: 36,742,107 T477A probably benign Het
Tmem208 C T 8: 105,328,225 A53V probably benign Het
Tpp2 A G 1: 43,981,748 T837A possibly damaging Het
Tulp4 A T 17: 6,201,733 N60I probably damaging Het
Ubqlnl A T 7: 104,148,938 W451R probably damaging Het
Usp53 G T 3: 122,953,307 C363* probably null Het
Usp7 A T 16: 8,691,418 H1017Q probably benign Het
Utp4 A G 8: 106,922,898 T660A possibly damaging Het
Vmn1r194 A T 13: 22,244,471 Y86F probably benign Het
Vmn1r195 A T 13: 22,279,239 H293L possibly damaging Het
Vmn1r231 T C 17: 20,889,736 R306G probably benign Het
Vmn2r63 T C 7: 42,927,090 probably benign Het
Vmn2r77 T C 7: 86,800,756 V70A probably benign Het
Vmn2r85 T C 10: 130,425,901 D189G probably damaging Het
Vps8 A G 16: 21,477,523 E515G possibly damaging Het
Wdr18 C A 10: 79,961,103 Y104* probably null Het
Wnk4 A T 11: 101,265,435 D43V probably damaging Het
Xab2 A T 8: 3,613,880 N346K probably damaging Het
Xirp2 T C 2: 67,512,140 V1575A possibly damaging Het
Zdhhc12 C T 2: 30,092,535 R50H probably damaging Het
Zdhhc8 A G 16: 18,225,200 S379P probably benign Het
Zfp458 G A 13: 67,259,609 Q58* probably null Het
Zfp747 A T 7: 127,374,600 S133T probably benign Het
Other mutations in Rfx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Rfx2 APN 17 56783657 missense probably damaging 1.00
IGL01296:Rfx2 APN 17 56808317 start codon destroyed possibly damaging 0.81
IGL01488:Rfx2 APN 17 56805398 missense probably damaging 1.00
IGL01705:Rfx2 APN 17 56785303 missense possibly damaging 0.88
IGL02389:Rfx2 APN 17 56808325 splice site probably benign
IGL02601:Rfx2 APN 17 56785354 missense possibly damaging 0.75
IGL02609:Rfx2 APN 17 56805404 missense probably benign 0.00
R0066:Rfx2 UTSW 17 56786736 splice site probably benign
R0197:Rfx2 UTSW 17 56803722 missense probably damaging 0.99
R0370:Rfx2 UTSW 17 56799308 missense probably benign 0.03
R0413:Rfx2 UTSW 17 56784418 splice site probably benign
R0622:Rfx2 UTSW 17 56777071 missense probably damaging 0.99
R0883:Rfx2 UTSW 17 56803722 missense probably damaging 0.99
R1429:Rfx2 UTSW 17 56804369 missense probably damaging 0.97
R1439:Rfx2 UTSW 17 56787720 missense probably damaging 1.00
R1569:Rfx2 UTSW 17 56804326 missense possibly damaging 0.63
R1654:Rfx2 UTSW 17 56808263 missense probably benign 0.00
R1751:Rfx2 UTSW 17 56784754 missense probably benign 0.01
R1816:Rfx2 UTSW 17 56808305 nonsense probably null
R2282:Rfx2 UTSW 17 56803722 missense probably damaging 0.99
R3408:Rfx2 UTSW 17 56803526 missense probably benign 0.00
R3962:Rfx2 UTSW 17 56785302 missense probably damaging 0.99
R4415:Rfx2 UTSW 17 56787733 missense possibly damaging 0.95
R4876:Rfx2 UTSW 17 56784706 missense probably benign 0.00
R4883:Rfx2 UTSW 17 56783747 missense probably damaging 0.98
R5588:Rfx2 UTSW 17 56779890 missense possibly damaging 0.69
R5766:Rfx2 UTSW 17 56803587 missense probably benign 0.02
R5798:Rfx2 UTSW 17 56804362 missense possibly damaging 0.89
R5931:Rfx2 UTSW 17 56780778 missense probably damaging 0.99
R6061:Rfx2 UTSW 17 56777473 missense possibly damaging 0.86
R6466:Rfx2 UTSW 17 56784397 missense probably benign 0.13
R6800:Rfx2 UTSW 17 56780804 missense probably damaging 0.99
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- atagtcacagtaagtgggcag -3'
Posted On2013-05-23