Incidental Mutation 'R5508:Flvcr1'
ID431018
Institutional Source Beutler Lab
Gene Symbol Flvcr1
Ensembl Gene ENSMUSG00000066595
Gene Namefeline leukemia virus subgroup C cellular receptor 1
SynonymsMfsd7b, 9630055N22Rik
MMRRC Submission 043069-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5508 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location191005847-191026158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 191025459 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 212 (G212D)
Ref Sequence ENSEMBL: ENSMUSP00000141578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085635] [ENSMUST00000191946] [ENSMUST00000192666]
Predicted Effect probably damaging
Transcript: ENSMUST00000085635
AA Change: G212D

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000082777
Gene: ENSMUSG00000066595
AA Change: G212D

DomainStartEndE-ValueType
low complexity region 40 68 N/A INTRINSIC
Pfam:MFS_1 100 483 1.5e-28 PFAM
transmembrane domain 498 517 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181050
SMART Domains Protein: ENSMUSP00000138069
Gene: ENSMUSG00000097845

DomainStartEndE-ValueType
low complexity region 97 106 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
low complexity region 246 265 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191946
AA Change: G212D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141578
Gene: ENSMUSG00000066595
AA Change: G212D

DomainStartEndE-ValueType
low complexity region 40 68 N/A INTRINSIC
Pfam:MFS_1 96 243 2.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192407
Predicted Effect probably damaging
Transcript: ENSMUST00000192666
AA Change: G170D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141985
Gene: ENSMUSG00000066595
AA Change: G170D

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
Pfam:MFS_1 54 198 3.1e-9 PFAM
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.7%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the major facilitator superfamily of transporter proteins. The encoded protein is a heme transporter that may play a critical role in erythropoiesis by protecting developing erythroid cells from heme toxicity. This gene may play a role in posterior column ataxia with retinitis pigmentosa and the hematological disorder Diamond-Blackfan syndrome. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit runting, cardiomegaly and splenomegaly, lack definitive erythropoiesis, develop severe hyperchromic macrocytic anemia and reticulocytopenia, and show craniofacial and limb defects and intrauterine lethality modulated by genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,538,084 probably null Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Apc A G 18: 34,298,580 D344G probably damaging Het
Asphd2 A T 5: 112,386,783 F300I probably damaging Het
BC016579 T A 16: 45,633,006 T149S possibly damaging Het
Bcl6b A T 11: 70,226,093 H453Q probably damaging Het
Clec4b2 A G 6: 123,173,042 probably benign Het
Crispld1 G T 1: 17,752,983 C396F probably damaging Het
Dnase1l3 A G 14: 7,968,146 V253A probably damaging Het
Efhd1 A G 1: 87,309,794 *241W probably null Het
Golga2 T A 2: 32,288,187 L36* probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf3c2 G T 5: 31,174,461 C4* probably null Het
Kit G T 5: 75,649,548 C786F probably damaging Het
Klf14 T C 6: 30,958,042 H219R probably damaging Het
Large2 A G 2: 92,369,903 V122A possibly damaging Het
Lct G A 1: 128,294,131 A1557V probably damaging Het
Lrp6 T G 6: 134,464,516 K1162N probably benign Het
Mtmr11 G A 3: 96,163,767 R147Q probably damaging Het
Pbld2 T A 10: 63,066,665 probably null Het
Pcdhb3 A T 18: 37,301,126 L48F probably damaging Het
Pdcd2 C T 17: 15,521,739 D310N probably damaging Het
Phlpp1 G T 1: 106,364,390 R993L probably benign Het
Prr36 G A 8: 4,216,488 P21S probably damaging Het
Ptprq C A 10: 107,686,231 V620L probably benign Het
Ranbp2 T A 10: 58,480,005 D2182E probably damaging Het
Sass6 G A 3: 116,620,103 R485K probably benign Het
Scoc A T 8: 83,435,942 S68T probably damaging Het
Speer3 T A 5: 13,794,664 L114I probably damaging Het
Ss18l1 C G 2: 180,057,653 Q215E probably damaging Het
Stab2 T C 10: 86,960,279 N368S probably benign Het
Trim80 T A 11: 115,445,078 S275R probably benign Het
Tubb5 T C 17: 35,835,070 N416S probably benign Het
Ugt2a3 A T 5: 87,327,200 M395K probably damaging Het
Vmn2r61 T A 7: 42,266,818 M285K possibly damaging Het
Xpo1 A G 11: 23,294,645 I1008V probably benign Het
Other mutations in Flvcr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Flvcr1 APN 1 191015489 nonsense probably null
IGL01089:Flvcr1 APN 1 191013390 missense probably damaging 0.98
IGL02572:Flvcr1 APN 1 191025646 missense probably damaging 1.00
IGL03248:Flvcr1 APN 1 191025742 missense probably damaging 1.00
R0009:Flvcr1 UTSW 1 191008191 missense probably benign
R0122:Flvcr1 UTSW 1 191021226 missense possibly damaging 0.79
R0363:Flvcr1 UTSW 1 191012254 splice site probably benign
R0417:Flvcr1 UTSW 1 191011219 missense probably benign 0.05
R0718:Flvcr1 UTSW 1 191025582 missense probably damaging 1.00
R1061:Flvcr1 UTSW 1 191008173 missense probably benign 0.01
R1815:Flvcr1 UTSW 1 191025380 missense probably damaging 1.00
R2029:Flvcr1 UTSW 1 191021156 missense probably benign 0.01
R4590:Flvcr1 UTSW 1 191012146 missense probably benign 0.05
R4766:Flvcr1 UTSW 1 191021106 missense probably benign 0.00
R4889:Flvcr1 UTSW 1 191025567 missense probably damaging 1.00
R4976:Flvcr1 UTSW 1 191025495 missense probably damaging 1.00
R5434:Flvcr1 UTSW 1 191026009 missense probably benign 0.07
R5930:Flvcr1 UTSW 1 191009551 missense probably damaging 1.00
R6698:Flvcr1 UTSW 1 191025732 missense probably damaging 1.00
R6927:Flvcr1 UTSW 1 191025664 missense possibly damaging 0.66
R7544:Flvcr1 UTSW 1 191025946 missense probably damaging 0.99
X0064:Flvcr1 UTSW 1 191025447 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TTACCGCCAGTTTCCAAGC -3'
(R):5'- AACTGGCTGTCCATGGTGTAC -3'

Sequencing Primer
(F):5'- TCAGTGCTGGCTGGGAATACAC -3'
(R):5'- TACATGGTGGCCTACGTGC -3'
Posted On2016-10-05