Incidental Mutation 'R5516:Ptprk'
ID431298
Institutional Source Beutler Lab
Gene Symbol Ptprk
Ensembl Gene ENSMUSG00000019889
Gene Nameprotein tyrosine phosphatase, receptor type, K
SynonymsRPTPkappa, PTPk
MMRRC Submission 043075-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5516 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location28074820-28597397 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 28496930 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 726 (R726*)
Ref Sequence ENSEMBL: ENSMUSP00000151986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359]
Predicted Effect probably null
Transcript: ENSMUST00000166468
AA Change: R726*
SMART Domains Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889
AA Change: R726*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
MAM 30 193 1.61e-73 SMART
IG 200 288 2.16e-8 SMART
FN3 290 373 1.48e-4 SMART
FN3 389 475 4.24e1 SMART
FN3 491 579 3.32e-7 SMART
transmembrane domain 753 774 N/A INTRINSIC
PTPc 898 1161 3.56e-132 SMART
PTPc 1190 1455 2.68e-86 SMART
Predicted Effect probably null
Transcript: ENSMUST00000218276
AA Change: R726*
Predicted Effect probably null
Transcript: ENSMUST00000218359
AA Change: R726*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219478
Meta Mutation Damage Score 0.6136 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.4%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,431,157 K334R probably damaging Het
Aldh1l1 A T 6: 90,596,945 I809F possibly damaging Het
Bmp2k T A 5: 97,087,453 probably benign Het
C1qtnf9 T A 14: 60,779,749 C243S probably damaging Het
Cacna1c G A 6: 119,057,218 A146V probably damaging Het
Ccdc85c A G 12: 108,207,850 V353A probably damaging Het
Cd300ld2 G T 11: 115,012,444 probably benign Het
Cd320 A G 17: 33,848,047 Q170R possibly damaging Het
Cfap43 C T 19: 47,738,209 probably null Het
Chid1 A G 7: 141,496,146 S365P probably damaging Het
Chrna7 T G 7: 63,099,298 T479P probably damaging Het
Clasp1 G T 1: 118,497,721 R35L probably damaging Het
Cluh G A 11: 74,660,444 R373H probably damaging Het
Cyp2b23 G A 7: 26,673,057 R378* probably null Het
Cyp2d9 T G 15: 82,454,327 N136K probably null Het
Efcab5 A T 11: 77,188,789 S44T possibly damaging Het
Esrrg A T 1: 188,198,730 L316F possibly damaging Het
Fam222a T C 5: 114,611,828 Y362H probably damaging Het
Fat3 A G 9: 15,998,709 V1999A probably damaging Het
Fes A T 7: 80,387,183 M51K probably damaging Het
Fmo3 T A 1: 162,954,426 K453* probably null Het
Galnt1 A G 18: 24,280,017 N458S probably benign Het
Gm13083 A G 4: 143,615,683 Q120R possibly damaging Het
Gm8888 T A 15: 96,766,974 noncoding transcript Het
Gpn2 G A 4: 133,584,879 probably null Het
Grm4 G A 17: 27,438,411 T464I probably benign Het
Insr T A 8: 3,155,764 K1342* probably null Het
Krt83 T A 15: 101,487,121 K365* probably null Het
Lfng T C 5: 140,613,263 L309P probably damaging Het
Lnpk T C 2: 74,547,788 probably benign Het
Lrrc8e A C 8: 4,235,818 D681A probably damaging Het
Lyst G A 13: 13,644,122 D1326N probably benign Het
Mmp27 A G 9: 7,579,062 R413G probably null Het
Nags C T 11: 102,145,947 Q121* probably null Het
Nectin1 A G 9: 43,803,793 E442G probably benign Het
Nek1 G C 8: 61,089,489 A729P probably benign Het
Olfr645 A G 7: 104,084,237 I281T possibly damaging Het
Pnp2 C T 14: 50,963,738 A189V probably benign Het
Ppm1m T A 9: 106,197,939 I136F probably damaging Het
Psg17 G T 7: 18,814,533 Q438K probably benign Het
Rab3gap2 A T 1: 185,235,487 Y163F probably benign Het
Scrib A T 15: 76,062,863 L627Q possibly damaging Het
Tcp1 A G 17: 12,924,334 K510R probably damaging Het
Tle4 A T 19: 14,454,889 I481N probably damaging Het
Tmem43 G T 6: 91,478,210 R56L possibly damaging Het
Trmt10a T C 3: 138,152,196 I168T possibly damaging Het
Trpv1 A T 11: 73,245,983 Y96F probably benign Het
Tshz3 C T 7: 36,770,350 T588I probably benign Het
Ugt2b38 A G 5: 87,411,843 F397L probably damaging Het
Vmn2r11 A G 5: 109,047,166 S765P probably damaging Het
Zfp668 A G 7: 127,867,146 F289L probably damaging Het
Zfp735 A G 11: 73,710,814 T195A probably benign Het
Zscan10 A G 17: 23,609,359 T182A possibly damaging Het
Other mutations in Ptprk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Ptprk APN 10 28336510 missense possibly damaging 0.92
IGL00533:Ptprk APN 10 28585975 missense probably damaging 0.97
IGL01062:Ptprk APN 10 28580418 missense probably damaging 1.00
IGL01295:Ptprk APN 10 28475178 missense probably benign 0.14
IGL01372:Ptprk APN 10 28569927 missense probably benign 0.00
IGL01452:Ptprk APN 10 28574917 critical splice donor site probably null
IGL01829:Ptprk APN 10 28573387 missense probably damaging 1.00
IGL01861:Ptprk APN 10 28383445 missense possibly damaging 0.80
IGL01955:Ptprk APN 10 28595865 unclassified probably benign
IGL02263:Ptprk APN 10 28075114 missense unknown
IGL02489:Ptprk APN 10 28383472 missense probably damaging 1.00
IGL02697:Ptprk APN 10 28575618 missense possibly damaging 0.85
IGL02713:Ptprk APN 10 28592811 missense possibly damaging 0.92
IGL02943:Ptprk APN 10 28475176 missense possibly damaging 0.81
IGL03240:Ptprk APN 10 28492961 missense probably damaging 0.99
IGL03373:Ptprk APN 10 28566537 missense probably damaging 1.00
LCD18:Ptprk UTSW 10 28574987 intron probably benign
PIT4366001:Ptprk UTSW 10 28586019 missense probably benign
R0010:Ptprk UTSW 10 28585969 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0053:Ptprk UTSW 10 28475109 missense probably damaging 0.99
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0244:Ptprk UTSW 10 28206225 missense possibly damaging 0.79
R0281:Ptprk UTSW 10 28573392 missense probably damaging 1.00
R0387:Ptprk UTSW 10 28354629 missense possibly damaging 0.66
R0480:Ptprk UTSW 10 28585947 missense probably damaging 1.00
R0480:Ptprk UTSW 10 28585948 missense probably damaging 1.00
R0585:Ptprk UTSW 10 28575668 missense probably damaging 1.00
R0614:Ptprk UTSW 10 28075136 missense probably damaging 0.96
R0684:Ptprk UTSW 10 28483298 splice site probably benign
R1073:Ptprk UTSW 10 28496947 critical splice donor site probably null
R1377:Ptprk UTSW 10 28586026 missense probably benign 0.42
R1422:Ptprk UTSW 10 28475280 missense possibly damaging 0.64
R1482:Ptprk UTSW 10 28263516 missense probably benign 0.24
R1532:Ptprk UTSW 10 28585630 missense probably damaging 1.00
R1576:Ptprk UTSW 10 28551651 missense probably damaging 1.00
R1618:Ptprk UTSW 10 28493170 missense probably benign 0.00
R1654:Ptprk UTSW 10 28383647 missense probably damaging 1.00
R1701:Ptprk UTSW 10 28466058 missense probably damaging 1.00
R1747:Ptprk UTSW 10 28354692 missense possibly damaging 0.78
R2033:Ptprk UTSW 10 28592767 unclassified probably benign
R2059:Ptprk UTSW 10 28566603 missense probably damaging 1.00
R2076:Ptprk UTSW 10 28589368 missense probably damaging 0.98
R2164:Ptprk UTSW 10 28560142 missense probably damaging 1.00
R2260:Ptprk UTSW 10 28206149 missense possibly damaging 0.65
R2394:Ptprk UTSW 10 28551717 missense probably damaging 0.98
R2432:Ptprk UTSW 10 28592844 missense probably damaging 1.00
R2437:Ptprk UTSW 10 28354713 missense probably damaging 1.00
R2495:Ptprk UTSW 10 28475078 splice site probably benign
R3037:Ptprk UTSW 10 28580478 missense probably damaging 1.00
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3687:Ptprk UTSW 10 28473043 missense probably damaging 1.00
R3722:Ptprk UTSW 10 28383623 missense probably damaging 1.00
R3892:Ptprk UTSW 10 28263621 missense probably benign 0.02
R3963:Ptprk UTSW 10 28551665 missense probably damaging 0.99
R4077:Ptprk UTSW 10 28263512 missense probably benign
R4079:Ptprk UTSW 10 28263512 missense probably benign
R4112:Ptprk UTSW 10 28475288 critical splice donor site probably null
R4255:Ptprk UTSW 10 28206245 missense probably benign 0.14
R4523:Ptprk UTSW 10 28466052 missense probably damaging 0.99
R4651:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4652:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4828:Ptprk UTSW 10 28560054 missense probably damaging 1.00
R4829:Ptprk UTSW 10 28580484 nonsense probably null
R4883:Ptprk UTSW 10 28588932 missense probably damaging 1.00
R5004:Ptprk UTSW 10 28586063 missense possibly damaging 0.95
R5013:Ptprk UTSW 10 28551717 missense probably damaging 0.99
R5092:Ptprk UTSW 10 28592773 missense probably damaging 1.00
R5126:Ptprk UTSW 10 28575644 unclassified probably null
R5183:Ptprk UTSW 10 28475236 missense probably benign 0.02
R5264:Ptprk UTSW 10 28585586 missense probably damaging 1.00
R5304:Ptprk UTSW 10 28592054 splice site probably null
R5330:Ptprk UTSW 10 28587080 missense probably damaging 1.00
R5474:Ptprk UTSW 10 28496930 nonsense probably null
R5796:Ptprk UTSW 10 28383575 missense probably damaging 1.00
R5843:Ptprk UTSW 10 28493064 missense probably damaging 0.99
R5952:Ptprk UTSW 10 28585675 missense probably damaging 0.99
R6065:Ptprk UTSW 10 28475170 missense probably damaging 1.00
R6226:Ptprk UTSW 10 28564103 missense probably benign 0.02
R6264:Ptprk UTSW 10 28566673 missense probably damaging 1.00
R6638:Ptprk UTSW 10 28595811 missense probably damaging 1.00
R6843:Ptprk UTSW 10 28591982 missense possibly damaging 0.86
R6860:Ptprk UTSW 10 28334484 missense probably damaging 1.00
R6869:Ptprk UTSW 10 28473059 critical splice donor site probably null
R7214:Ptprk UTSW 10 28574909 missense probably benign 0.11
R7307:Ptprk UTSW 10 28589008 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCTGCCATACCTAAGCTTG -3'
(R):5'- CACTGCATGTAATAGGTCTGAAAC -3'

Sequencing Primer
(F):5'- CCTAAGCTTGCTTTATTACCAAGTG -3'
(R):5'- GCATGTAATAGGTCTGAAACAATGAC -3'
Posted On2016-10-05