Incidental Mutation 'R6226:Ptprk'
ID504348
Institutional Source Beutler Lab
Gene Symbol Ptprk
Ensembl Gene ENSMUSG00000019889
Gene Nameprotein tyrosine phosphatase, receptor type, K
SynonymsRPTPkappa, PTPk
MMRRC Submission 044397-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6226 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location28074820-28597397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28564103 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 856 (T856A)
Ref Sequence ENSEMBL: ENSMUSP00000151866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359]
Predicted Effect probably benign
Transcript: ENSMUST00000166468
SMART Domains Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
MAM 30 193 1.61e-73 SMART
IG 200 288 2.16e-8 SMART
FN3 290 373 1.48e-4 SMART
FN3 389 475 4.24e1 SMART
FN3 491 579 3.32e-7 SMART
transmembrane domain 753 774 N/A INTRINSIC
PTPc 898 1161 3.56e-132 SMART
PTPc 1190 1455 2.68e-86 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218276
AA Change: T856A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000218359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219478
Predicted Effect probably benign
Transcript: ENSMUST00000219621
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 T C 13: 12,278,967 T62A probably benign Het
Adam33 G A 2: 131,055,610 T265I probably damaging Het
Afap1l2 T C 19: 56,916,128 T654A probably benign Het
Agrn A G 4: 156,173,609 S992P probably damaging Het
Anapc1 A G 2: 128,650,372 F939L probably damaging Het
Anks1 G A 17: 28,057,330 V1016I probably benign Het
Ankzf1 A G 1: 75,196,594 T401A probably benign Het
Atad1 G T 19: 32,701,587 D105E probably benign Het
AU019823 T C 9: 50,607,770 T181A possibly damaging Het
Carmil2 A G 8: 105,689,032 T313A possibly damaging Het
Cdk15 T C 1: 59,265,633 V131A probably damaging Het
Cldnd1 A T 16: 58,731,300 probably null Het
Col16a1 A T 4: 130,055,089 probably benign Het
Cts3 T A 13: 61,568,721 I34L probably benign Het
Dnah7b A C 1: 46,126,668 K498Q probably benign Het
Dnase2b A G 3: 146,584,563 Y218H probably benign Het
Dsg2 T A 18: 20,579,449 V170D probably damaging Het
Dst T C 1: 34,270,874 V1543A probably damaging Het
Ell3 A T 2: 121,441,777 I72K probably damaging Het
Fank1 A G 7: 133,862,198 Y41C probably benign Het
Foxd3 T C 4: 99,657,024 Y134H probably damaging Het
Frmd6 A G 12: 70,863,911 probably benign Het
Gale A G 4: 135,965,605 E53G possibly damaging Het
Glis3 A G 19: 28,317,302 S699P probably damaging Het
Gm12830 T A 4: 114,845,049 M136K unknown Het
Grik3 T C 4: 125,659,789 V438A probably benign Het
Gsap A G 5: 21,217,431 N133D probably damaging Het
Gsg1 T A 6: 135,240,112 D239V probably damaging Het
H2-T10 A T 17: 36,121,083 W23R probably damaging Het
Itgae A G 11: 73,140,757 T1100A probably benign Het
Kcnh7 A T 2: 62,777,559 F559L probably damaging Het
Kdm5b G T 1: 134,608,878 R612L probably damaging Het
Lrrc74a T A 12: 86,748,457 N253K possibly damaging Het
Mcm3ap A G 10: 76,515,706 H1961R possibly damaging Het
Ncam1 C T 9: 49,565,004 E262K probably benign Het
Nckap1 A G 2: 80,508,781 S968P possibly damaging Het
Nr2f2 T G 7: 70,359,996 S112R probably benign Het
Nup93 T C 8: 94,286,537 W137R probably damaging Het
Olfr1115 A G 2: 87,252,392 S152G probably benign Het
Olfr1251 A T 2: 89,666,989 L299H probably damaging Het
Olfr1395 A G 11: 49,148,833 D192G possibly damaging Het
Olfr664 A T 7: 104,734,036 F109L probably damaging Het
Olfr874 T A 9: 37,746,137 M1K probably null Het
Olfr922 T C 9: 38,816,370 I289T probably damaging Het
Otogl A T 10: 107,771,206 Y2105* probably null Het
Pibf1 A G 14: 99,101,119 S24G probably damaging Het
Pitx2 C T 3: 129,215,842 R130W probably damaging Het
Pkd1l1 T C 11: 8,901,287 N715S probably benign Het
Pou6f2 A T 13: 18,129,154 I123N possibly damaging Het
Prss29 T A 17: 25,320,539 H35Q possibly damaging Het
Ptpn21 A G 12: 98,680,116 F1028L probably benign Het
Ptpn21 A T 12: 98,715,172 Y68N probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpl22l1 A G 3: 28,806,527 T13A possibly damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Sec14l5 G A 16: 5,176,565 V408I probably damaging Het
Serpina5 T C 12: 104,101,778 S33P possibly damaging Het
Sgip1 A G 4: 102,966,195 N524S probably damaging Het
Shkbp1 C A 7: 27,351,980 R218M probably null Het
Sorcs1 T A 19: 50,181,414 I970F probably damaging Het
Spg11 A G 2: 122,088,262 V962A possibly damaging Het
Sptbn1 A G 11: 30,136,054 M1205T probably damaging Het
Sufu G A 19: 46,473,654 V369M probably damaging Het
Tmem98 T C 11: 80,821,394 F219S probably benign Het
Trim27 T C 13: 21,180,916 probably benign Het
Trim43b T C 9: 89,091,275 E135G possibly damaging Het
Ube2m A G 7: 13,035,888 V110A probably damaging Het
Ugt2b36 A G 5: 87,092,130 V132A probably damaging Het
Usp36 A T 11: 118,277,274 S86T probably damaging Het
Zfp941 A T 7: 140,812,485 D320E probably benign Het
Other mutations in Ptprk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Ptprk APN 10 28336510 missense possibly damaging 0.92
IGL00533:Ptprk APN 10 28585975 missense probably damaging 0.97
IGL01062:Ptprk APN 10 28580418 missense probably damaging 1.00
IGL01295:Ptprk APN 10 28475178 missense probably benign 0.14
IGL01372:Ptprk APN 10 28569927 missense probably benign 0.00
IGL01452:Ptprk APN 10 28574917 critical splice donor site probably null
IGL01829:Ptprk APN 10 28573387 missense probably damaging 1.00
IGL01861:Ptprk APN 10 28383445 missense possibly damaging 0.80
IGL01955:Ptprk APN 10 28595865 unclassified probably benign
IGL02263:Ptprk APN 10 28075114 missense unknown
IGL02489:Ptprk APN 10 28383472 missense probably damaging 1.00
IGL02697:Ptprk APN 10 28575618 missense possibly damaging 0.85
IGL02713:Ptprk APN 10 28592811 missense possibly damaging 0.92
IGL02943:Ptprk APN 10 28475176 missense possibly damaging 0.81
IGL03240:Ptprk APN 10 28492961 missense probably damaging 0.99
IGL03373:Ptprk APN 10 28566537 missense probably damaging 1.00
LCD18:Ptprk UTSW 10 28574987 intron probably benign
PIT4366001:Ptprk UTSW 10 28586019 missense probably benign
R0010:Ptprk UTSW 10 28585969 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0053:Ptprk UTSW 10 28475109 missense probably damaging 0.99
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0244:Ptprk UTSW 10 28206225 missense possibly damaging 0.79
R0281:Ptprk UTSW 10 28573392 missense probably damaging 1.00
R0387:Ptprk UTSW 10 28354629 missense possibly damaging 0.66
R0480:Ptprk UTSW 10 28585947 missense probably damaging 1.00
R0480:Ptprk UTSW 10 28585948 missense probably damaging 1.00
R0585:Ptprk UTSW 10 28575668 missense probably damaging 1.00
R0614:Ptprk UTSW 10 28075136 missense probably damaging 0.96
R0684:Ptprk UTSW 10 28483298 splice site probably benign
R1073:Ptprk UTSW 10 28496947 critical splice donor site probably null
R1377:Ptprk UTSW 10 28586026 missense probably benign 0.42
R1422:Ptprk UTSW 10 28475280 missense possibly damaging 0.64
R1482:Ptprk UTSW 10 28263516 missense probably benign 0.24
R1532:Ptprk UTSW 10 28585630 missense probably damaging 1.00
R1576:Ptprk UTSW 10 28551651 missense probably damaging 1.00
R1618:Ptprk UTSW 10 28493170 missense probably benign 0.00
R1654:Ptprk UTSW 10 28383647 missense probably damaging 1.00
R1701:Ptprk UTSW 10 28466058 missense probably damaging 1.00
R1747:Ptprk UTSW 10 28354692 missense possibly damaging 0.78
R2033:Ptprk UTSW 10 28592767 unclassified probably benign
R2059:Ptprk UTSW 10 28566603 missense probably damaging 1.00
R2076:Ptprk UTSW 10 28589368 missense probably damaging 0.98
R2164:Ptprk UTSW 10 28560142 missense probably damaging 1.00
R2260:Ptprk UTSW 10 28206149 missense possibly damaging 0.65
R2394:Ptprk UTSW 10 28551717 missense probably damaging 0.98
R2432:Ptprk UTSW 10 28592844 missense probably damaging 1.00
R2437:Ptprk UTSW 10 28354713 missense probably damaging 1.00
R2495:Ptprk UTSW 10 28475078 splice site probably benign
R3037:Ptprk UTSW 10 28580478 missense probably damaging 1.00
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3687:Ptprk UTSW 10 28473043 missense probably damaging 1.00
R3722:Ptprk UTSW 10 28383623 missense probably damaging 1.00
R3892:Ptprk UTSW 10 28263621 missense probably benign 0.02
R3963:Ptprk UTSW 10 28551665 missense probably damaging 0.99
R4077:Ptprk UTSW 10 28263512 missense probably benign
R4079:Ptprk UTSW 10 28263512 missense probably benign
R4112:Ptprk UTSW 10 28475288 critical splice donor site probably null
R4255:Ptprk UTSW 10 28206245 missense probably benign 0.14
R4523:Ptprk UTSW 10 28466052 missense probably damaging 0.99
R4651:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4652:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4828:Ptprk UTSW 10 28560054 missense probably damaging 1.00
R4829:Ptprk UTSW 10 28580484 nonsense probably null
R4883:Ptprk UTSW 10 28588932 missense probably damaging 1.00
R5004:Ptprk UTSW 10 28586063 missense possibly damaging 0.95
R5013:Ptprk UTSW 10 28551717 missense probably damaging 0.99
R5092:Ptprk UTSW 10 28592773 missense probably damaging 1.00
R5126:Ptprk UTSW 10 28575644 unclassified probably null
R5183:Ptprk UTSW 10 28475236 missense probably benign 0.02
R5264:Ptprk UTSW 10 28585586 missense probably damaging 1.00
R5304:Ptprk UTSW 10 28592054 splice site probably null
R5330:Ptprk UTSW 10 28587080 missense probably damaging 1.00
R5474:Ptprk UTSW 10 28496930 nonsense probably null
R5516:Ptprk UTSW 10 28496930 nonsense probably null
R5796:Ptprk UTSW 10 28383575 missense probably damaging 1.00
R5843:Ptprk UTSW 10 28493064 missense probably damaging 0.99
R5952:Ptprk UTSW 10 28585675 missense probably damaging 0.99
R6065:Ptprk UTSW 10 28475170 missense probably damaging 1.00
R6264:Ptprk UTSW 10 28566673 missense probably damaging 1.00
R6638:Ptprk UTSW 10 28595811 missense probably damaging 1.00
R6843:Ptprk UTSW 10 28591982 missense possibly damaging 0.86
R6860:Ptprk UTSW 10 28334484 missense probably damaging 1.00
R6869:Ptprk UTSW 10 28473059 critical splice donor site probably null
R7214:Ptprk UTSW 10 28574909 missense probably benign 0.11
R7307:Ptprk UTSW 10 28589008 nonsense probably null
R7349:Ptprk UTSW 10 28592838 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AAGCTGACTCTCATTAGTCCCATTAG -3'
(R):5'- AGTGGTACAATAGTCAGTAAGGTC -3'

Sequencing Primer
(F):5'- GACTCTCATTAGTCCCATTAGACATC -3'
(R):5'- GGTACAATAGTCAGTAAGGTCTTTTG -3'
Posted On2018-02-28