Incidental Mutation 'R5640:Thsd7b'
ID440578
Institutional Source Beutler Lab
Gene Symbol Thsd7b
Ensembl Gene ENSMUSG00000042581
Gene Namethrombospondin, type I, domain containing 7B
Synonyms1700074E13Rik, D130067I03Rik
MMRRC Submission 043289-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.309) question?
Stock #R5640 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location129273302-130219278 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 130116671 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 1129 (C1129*)
Ref Sequence ENSEMBL: ENSMUSP00000073220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073527]
Predicted Effect probably null
Transcript: ENSMUST00000073527
AA Change: C1129*
SMART Domains Protein: ENSMUSP00000073220
Gene: ENSMUSG00000042581
AA Change: C1129*

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Blast:TSP1 43 98 5e-29 BLAST
Blast:TSP1 122 177 9e-24 BLAST
TSP1 182 233 2.47e-9 SMART
TSP1 339 399 7e-9 SMART
Blast:TSP1 402 482 2e-27 BLAST
TSP1 487 543 2.12e-1 SMART
TSP1 604 661 3.9e-7 SMART
TSP1 664 735 2.73e-2 SMART
TSP1 740 796 1.01e-5 SMART
Blast:TSP1 799 869 6e-35 BLAST
TSP1 874 922 9.68e-3 SMART
TSP1 952 999 2.42e0 SMART
TSP1 1004 1059 3.96e-8 SMART
TSP1 1062 1126 1.73e0 SMART
TSP1 1131 1182 6.05e-4 SMART
TSP1 1185 1246 9.52e-1 SMART
TSP1 1251 1303 3.21e-8 SMART
TSP1 1304 1369 5.52e-1 SMART
TSP1 1374 1432 3.92e-2 SMART
transmembrane domain 1558 1580 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151700
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace A G 11: 105,970,685 Y220C probably damaging Het
Actl6a A G 3: 32,718,050 T170A probably damaging Het
Adamts8 T C 9: 30,956,500 V540A probably benign Het
Aga T C 8: 53,511,884 L27P probably damaging Het
Agmat T A 4: 141,755,823 H189Q probably damaging Het
Alx3 C A 3: 107,600,661 T162K probably damaging Het
Armc2 T A 10: 42,011,898 I30L possibly damaging Het
Arntl C T 7: 113,308,681 P530L probably damaging Het
Atp10d T G 5: 72,247,209 Y487D probably damaging Het
Atp13a4 C T 16: 29,415,831 M908I probably damaging Het
B4galt2 T G 4: 117,873,998 N322T probably benign Het
Brdt A T 5: 107,359,308 K525* probably null Het
Ces3a T A 8: 105,051,745 M246K probably benign Het
Chd9 T A 8: 91,036,562 H2338Q probably damaging Het
Cyp3a16 T A 5: 145,452,823 D244V possibly damaging Het
Dhrs9 C A 2: 69,394,478 A170E probably damaging Het
Dlg5 T C 14: 24,170,461 N550D probably damaging Het
Dnah8 C T 17: 30,803,108 T3894I probably damaging Het
Dpys T C 15: 39,842,066 H217R probably damaging Het
Dpysl2 C T 14: 66,834,368 V108I probably benign Het
Eprs A G 1: 185,374,184 T199A probably benign Het
Fads1 A G 19: 10,186,403 D183G probably damaging Het
Fam110b T G 4: 5,798,689 Y36D probably damaging Het
Fbxl21 G A 13: 56,537,381 D407N probably benign Het
Fuca2 G A 10: 13,507,430 probably null Het
Gm8251 T C 1: 44,061,927 I4V probably benign Het
Gnas C A 2: 174,284,971 R100S probably benign Het
Gse1 A G 8: 120,562,677 H90R possibly damaging Het
Hoxc10 G T 15: 102,967,267 C137F probably benign Het
Ipp T G 4: 116,520,689 L252R possibly damaging Het
Jmjd1c T A 10: 67,226,078 S1403R probably benign Het
Kif19a A G 11: 114,779,215 M79V probably benign Het
Lipo4 T C 19: 33,501,586 T285A possibly damaging Het
Lrrc66 A T 5: 73,608,634 D355E probably benign Het
Lrsam1 T A 2: 32,945,852 Q301L probably benign Het
Med6 C T 12: 81,581,854 R138Q probably damaging Het
Nlrc5 A G 8: 94,475,793 T174A probably benign Het
Nrbp1 C T 5: 31,249,585 R322W possibly damaging Het
Olfr1256 T A 2: 89,835,938 E2D probably benign Het
Olfr1338 T A 4: 118,753,789 T250S probably benign Het
Olfr739 C A 14: 50,424,654 A45D probably benign Het
Pde3a A G 6: 141,483,915 E734G probably damaging Het
Pnpla7 C T 2: 25,003,001 T167I possibly damaging Het
Pop7 T C 5: 137,502,059 N4S possibly damaging Het
Ppm1h C A 10: 122,782,278 P114Q probably benign Het
Prdm16 T C 4: 154,341,910 T473A probably benign Het
Prdm6 T C 18: 53,536,741 probably null Het
Prkdc T G 16: 15,829,769 W3686G possibly damaging Het
Ptchd4 C A 17: 42,503,135 H642Q possibly damaging Het
Rad1 A G 15: 10,495,923 Y228C possibly damaging Het
Rgs22 G A 15: 36,106,955 T56I probably benign Het
Rnf135 C A 11: 80,193,907 H169N probably benign Het
Rnft1 C T 11: 86,486,493 Q128* probably null Het
Sez6 T C 11: 77,973,759 probably benign Het
Sh3rf3 A G 10: 58,813,947 S125G probably benign Het
Sik2 T C 9: 50,915,506 E295G possibly damaging Het
Themis A G 10: 28,863,376 Q614R probably damaging Het
Tmem68 A T 4: 3,569,512 F59L probably benign Het
Tmem8 C T 17: 26,118,872 T410I possibly damaging Het
Vmn2r107 A G 17: 20,375,164 T660A probably damaging Het
Vwa5b2 G T 16: 20,597,542 C484F probably damaging Het
Zfp418 T A 7: 7,181,981 C314* probably null Het
Other mutations in Thsd7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Thsd7b APN 1 129595834 missense probably damaging 1.00
IGL00850:Thsd7b APN 1 130165077 missense probably benign 0.00
IGL00987:Thsd7b APN 1 129613279 missense probably damaging 1.00
IGL01068:Thsd7b APN 1 129596146 missense probably damaging 1.00
IGL01091:Thsd7b APN 1 129776334 missense probably benign 0.29
IGL01535:Thsd7b APN 1 129678217 missense possibly damaging 0.64
IGL01560:Thsd7b APN 1 130218181 utr 3 prime probably benign
IGL01701:Thsd7b APN 1 129430928 missense probably benign 0.07
IGL01775:Thsd7b APN 1 129628939 missense probably damaging 0.99
IGL02077:Thsd7b APN 1 129816682 missense probably damaging 1.00
IGL02338:Thsd7b APN 1 129595771 missense probably damaging 1.00
IGL02340:Thsd7b APN 1 130159632 missense probably benign 0.01
IGL02404:Thsd7b APN 1 129613151 missense probably damaging 1.00
IGL02519:Thsd7b APN 1 129613195 missense probably benign 0.22
IGL02543:Thsd7b APN 1 130165103 missense probably benign 0.03
IGL02740:Thsd7b APN 1 129613127 missense probably damaging 0.99
IGL02793:Thsd7b APN 1 129951393 missense probably damaging 1.00
IGL02875:Thsd7b APN 1 129951393 missense probably damaging 1.00
IGL02986:Thsd7b APN 1 129915615 missense probably benign 0.01
IGL03108:Thsd7b APN 1 130210276 missense probably damaging 1.00
IGL03114:Thsd7b APN 1 130188551 missense probably benign 0.00
IGL03195:Thsd7b APN 1 129628909 missense probably damaging 1.00
IGL03291:Thsd7b APN 1 129760355 missense possibly damaging 0.94
IGL03397:Thsd7b APN 1 129596164 missense probably benign 0.17
IGL03399:Thsd7b APN 1 129628885 missense probably damaging 1.00
R0184:Thsd7b UTSW 1 129430964 missense probably benign 0.00
R0277:Thsd7b UTSW 1 130195263 missense probably benign 0.00
R0526:Thsd7b UTSW 1 129951392 missense probably damaging 1.00
R0633:Thsd7b UTSW 1 130188526 missense possibly damaging 0.78
R0746:Thsd7b UTSW 1 130188531 missense probably benign 0.00
R0784:Thsd7b UTSW 1 129595359 splice site probably benign
R1158:Thsd7b UTSW 1 130189935 synonymous probably null
R1267:Thsd7b UTSW 1 129628840 intron probably null
R1375:Thsd7b UTSW 1 130159686 missense probably damaging 1.00
R1565:Thsd7b UTSW 1 129596041 missense possibly damaging 0.94
R1728:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1728:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1728:Thsd7b UTSW 1 129678183 missense probably benign
R1728:Thsd7b UTSW 1 130116631 missense probably benign
R1729:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1729:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1729:Thsd7b UTSW 1 129678183 missense probably benign
R1729:Thsd7b UTSW 1 130116631 missense probably benign
R1730:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1730:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1730:Thsd7b UTSW 1 129678183 missense probably benign
R1730:Thsd7b UTSW 1 130116631 missense probably benign
R1739:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1739:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1739:Thsd7b UTSW 1 129678183 missense probably benign
R1739:Thsd7b UTSW 1 130116631 missense probably benign
R1762:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1762:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1762:Thsd7b UTSW 1 129678183 missense probably benign
R1762:Thsd7b UTSW 1 130103076 missense possibly damaging 0.92
R1762:Thsd7b UTSW 1 130116631 missense probably benign
R1783:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1783:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1783:Thsd7b UTSW 1 129678183 missense probably benign
R1783:Thsd7b UTSW 1 130116631 missense probably benign
R1784:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1784:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1784:Thsd7b UTSW 1 129678183 missense probably benign
R1784:Thsd7b UTSW 1 130116631 missense probably benign
R1785:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1785:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1785:Thsd7b UTSW 1 129678183 missense probably benign
R1785:Thsd7b UTSW 1 130116631 missense probably benign
R1812:Thsd7b UTSW 1 129758610 missense probably damaging 1.00
R1846:Thsd7b UTSW 1 129613256 missense probably damaging 1.00
R1908:Thsd7b UTSW 1 129678109 missense probably damaging 0.99
R1996:Thsd7b UTSW 1 129758451 nonsense probably null
R2199:Thsd7b UTSW 1 130218158 missense probably benign 0.04
R2483:Thsd7b UTSW 1 130103072 missense probably damaging 1.00
R2919:Thsd7b UTSW 1 130189850 splice site probably benign
R2935:Thsd7b UTSW 1 129678087 missense possibly damaging 0.83
R3113:Thsd7b UTSW 1 130049862 missense probably benign 0.23
R3236:Thsd7b UTSW 1 130218118 nonsense probably null
R3745:Thsd7b UTSW 1 129678241 missense probably benign 0.04
R3877:Thsd7b UTSW 1 130190182 missense possibly damaging 0.92
R3880:Thsd7b UTSW 1 129595370 missense probably damaging 1.00
R4110:Thsd7b UTSW 1 130116619 missense probably benign 0.18
R4112:Thsd7b UTSW 1 130116619 missense probably benign 0.18
R4255:Thsd7b UTSW 1 129760287 missense possibly damaging 0.79
R4621:Thsd7b UTSW 1 129430915 missense possibly damaging 0.47
R4703:Thsd7b UTSW 1 130049909 intron probably benign
R4732:Thsd7b UTSW 1 129613186 missense probably damaging 1.00
R4733:Thsd7b UTSW 1 129613186 missense probably damaging 1.00
R4755:Thsd7b UTSW 1 130210264 missense probably benign 0.01
R4805:Thsd7b UTSW 1 130188539 missense probably benign 0.04
R4840:Thsd7b UTSW 1 129595844 missense probably benign 0.00
R4879:Thsd7b UTSW 1 130188499 missense possibly damaging 0.62
R4936:Thsd7b UTSW 1 129678145 missense probably benign 0.00
R4972:Thsd7b UTSW 1 130188572 missense probably damaging 0.97
R5304:Thsd7b UTSW 1 129678243 nonsense probably null
R5422:Thsd7b UTSW 1 129921334 missense probably benign 0.41
R5495:Thsd7b UTSW 1 129595833 missense probably damaging 1.00
R5598:Thsd7b UTSW 1 129595841 missense probably damaging 1.00
R5620:Thsd7b UTSW 1 130162936 critical splice donor site probably null
R5638:Thsd7b UTSW 1 129595533 missense probably benign 0.00
R5655:Thsd7b UTSW 1 129628934 synonymous probably null
R5711:Thsd7b UTSW 1 129760402 missense probably damaging 1.00
R5823:Thsd7b UTSW 1 129678084 missense probably benign 0.00
R5888:Thsd7b UTSW 1 130210320 nonsense probably null
R5932:Thsd7b UTSW 1 129430838 missense probably benign
R6243:Thsd7b UTSW 1 130162862 missense probably benign 0.21
R6258:Thsd7b UTSW 1 129667918 missense probably benign
R6260:Thsd7b UTSW 1 129667918 missense probably benign
R6399:Thsd7b UTSW 1 129816648 missense probably benign 0.13
R6437:Thsd7b UTSW 1 129816682 missense probably damaging 1.00
R6719:Thsd7b UTSW 1 130159714 splice site probably null
R6785:Thsd7b UTSW 1 129430907 missense probably damaging 0.99
X0027:Thsd7b UTSW 1 129596072 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTTATCCTGTCGGGGTTCC -3'
(R):5'- CCCTTCAAGTTATGTGTGGGTTCC -3'

Sequencing Primer
(F):5'- CGGGGTTCCTTATTGAGTTATCAC -3'
(R):5'- GGGTTCCTGGGAAATATTCTTTTC -3'
Posted On2016-11-08