Incidental Mutation 'R5853:Lipo1'
ID454795
Institutional Source Beutler Lab
Gene Symbol Lipo1
Ensembl Gene ENSMUSG00000024766
Gene Namelipase, member O1
Synonyms
MMRRC Submission 044068-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5853 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location33517740-33590308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33782230 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 202 (V202A)
Ref Sequence ENSEMBL: ENSMUSP00000136249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178735]
Predicted Effect unknown
Transcript: ENSMUST00000148137
AA Change: V205A
SMART Domains Protein: ENSMUSP00000118385
Gene: ENSMUSG00000079342
AA Change: V205A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 37 99 2.8e-21 PFAM
Pfam:Hydrolase_4 76 239 4.3e-8 PFAM
Pfam:Abhydrolase_1 80 219 2.2e-17 PFAM
Pfam:Abhydrolase_5 80 233 8.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178735
AA Change: V202A

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000136249
Gene: ENSMUSG00000079342
AA Change: V202A

DomainStartEndE-ValueType
Pfam:Abhydro_lipase 33 95 1.3e-20 PFAM
Pfam:Hydrolase_4 72 231 3.5e-8 PFAM
Pfam:Abhydrolase_5 76 370 3.7e-10 PFAM
Pfam:Abhydrolase_1 76 376 6.8e-21 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 G A 7: 120,340,583 V303I probably benign Het
Abca4 G T 3: 122,103,531 V620L probably benign Het
Ankk1 A T 9: 49,418,695 V320E possibly damaging Het
Aoah G T 13: 20,999,902 A379S probably benign Het
Apol7e A G 15: 77,714,467 D44G probably benign Het
Atf2 T C 2: 73,828,469 probably null Het
Cd209b T C 8: 3,926,549 probably null Het
Chek1 G A 9: 36,713,687 S366L probably damaging Het
Chpf2 T C 5: 24,592,192 L712P probably damaging Het
Clmn C A 12: 104,783,902 probably null Het
Cnksr3 T C 10: 7,142,977 D178G probably benign Het
Cpox T C 16: 58,675,417 Y366H probably damaging Het
Dnah3 A G 7: 119,938,833 F3632S probably damaging Het
Eif5b T A 1: 38,037,307 D645E probably damaging Het
Emilin1 G A 5: 30,918,622 E736K probably damaging Het
Gcnt4 G A 13: 96,946,652 R152Q probably benign Het
Il6st T C 13: 112,481,537 S162P probably damaging Het
Iqub T C 6: 24,491,602 K362E probably benign Het
Kif22 G T 7: 127,033,367 P257Q possibly damaging Het
Lhx2 T C 2: 38,369,041 V378A probably damaging Het
Lrp1b T A 2: 40,663,726 N366I unknown Het
Mbip T C 12: 56,335,877 D268G probably damaging Het
Mc5r A G 18: 68,339,493 M308V probably benign Het
Mndal C A 1: 173,862,504 G420V probably damaging Het
Nbea A T 3: 55,992,401 N1442K probably damaging Het
Ndufv1 A T 19: 4,008,811 probably null Het
Ofcc1 A G 13: 40,206,717 S279P probably benign Het
Olfr1415 T C 1: 92,491,717 I13V probably benign Het
Olfr730 A T 14: 50,186,869 M116K possibly damaging Het
Pabpc1l A T 2: 164,049,518 H552L probably benign Het
Pigr T A 1: 130,846,604 C440* probably null Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Prss30 C T 17: 23,972,846 V271I probably damaging Het
Psme4 T A 11: 30,791,234 probably null Het
Qrich1 T A 9: 108,533,608 probably benign Het
Rem1 C G 2: 152,628,280 A62G possibly damaging Het
Rftn1 T C 17: 50,047,326 N58S probably damaging Het
Rp9 G A 9: 22,448,769 probably benign Het
Rrp1b G A 17: 32,056,684 V402I possibly damaging Het
Slc25a33 A T 4: 149,753,892 Y108N probably benign Het
Slc3a1 A G 17: 85,032,580 M189V probably damaging Het
Slc44a1 A C 4: 53,528,682 K144T probably benign Het
Tbc1d13 T A 2: 30,137,381 H100Q probably damaging Het
Timm29 T C 9: 21,593,453 V139A probably damaging Het
Tmem70 T C 1: 16,665,332 W9R possibly damaging Het
Tspan1 A G 4: 116,163,305 probably null Het
Unc13a T C 8: 71,655,129 probably null Het
Uroc1 T C 6: 90,346,756 F395S probably damaging Het
Uvrag A C 7: 98,888,077 L637R possibly damaging Het
Vmn1r213 T G 13: 23,011,514 L3W probably benign Het
Zfp280d C T 9: 72,330,942 T528I probably benign Het
Zfp526 C T 7: 25,225,176 Q287* probably null Het
Other mutations in Lipo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01521:Lipo1 APN 19 33785683 missense probably damaging 1.00
IGL01916:Lipo1 APN 19 33784782 missense probably damaging 1.00
IGL03005:Lipo1 APN 19 33785736 missense possibly damaging 0.65
R0646:Lipo1 UTSW 19 33784769 nonsense probably null
R1704:Lipo1 UTSW 19 33780343 missense possibly damaging 0.87
R1772:Lipo1 UTSW 19 33787421 missense probably benign 0.45
R1862:Lipo1 UTSW 19 33784692 missense probably damaging 1.00
R1863:Lipo1 UTSW 19 33784692 missense probably damaging 1.00
R3801:Lipo1 UTSW 19 33784857 missense probably damaging 0.99
R3802:Lipo1 UTSW 19 33784857 missense probably damaging 0.99
R3803:Lipo1 UTSW 19 33784857 missense probably damaging 0.99
R4020:Lipo1 UTSW 19 33787404 missense probably benign 0.00
R4648:Lipo1 UTSW 19 33783460 missense probably damaging 1.00
R4775:Lipo1 UTSW 19 33780395 missense probably damaging 1.00
R4787:Lipo1 UTSW 19 33780349 missense probably benign 0.00
R4830:Lipo1 UTSW 19 33776587 missense probably damaging 0.99
R4951:Lipo1 UTSW 19 33782221 missense probably benign 0.01
R5799:Lipo1 UTSW 19 33777693 intron probably benign
R6235:Lipo1 UTSW 19 33783563 missense probably damaging 0.96
R6296:Lipo1 UTSW 19 33780337 missense probably benign 0.10
R6913:Lipo1 UTSW 19 33780305 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACTTTCTGCAGCCATCAAGGG -3'
(R):5'- CAGGAACGAGTTTAAATGTCTGC -3'

Sequencing Primer
(F):5'- CTGCAGCCATCAAGGGAGGAG -3'
(R):5'- CGAGTTTAAATGTCTGCAAAAAGC -3'
Posted On2017-02-10