Incidental Mutation 'R5968:Crb1'
ID470684
Institutional Source Beutler Lab
Gene Symbol Crb1
Ensembl Gene ENSMUSG00000063681
Gene Namecrumbs family member 1, photoreceptor morphogenesis associated
Synonyms7530426H14Rik, A930008G09Rik
MMRRC Submission 043249-MU
Accession Numbers

Ncbi RefSeq: NM_133239.2; MGI: 2136343

Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R5968 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location139197056-139377100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139243001 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 823 (C823R)
Ref Sequence ENSEMBL: ENSMUSP00000142552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059825] [ENSMUST00000196402] [ENSMUST00000198445]
Predicted Effect probably damaging
Transcript: ENSMUST00000059825
AA Change: C884R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060769
Gene: ENSMUSG00000063681
AA Change: C884R

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
EGF 72 107 5.97e-4 SMART
EGF 112 145 9.19e-5 SMART
EGF_CA 147 183 2.89e-11 SMART
EGF_CA 185 221 1.14e-9 SMART
EGF_CA 223 259 2.26e-13 SMART
EGF_CA 261 298 5.15e-8 SMART
EGF 303 336 8.12e-6 SMART
EGF 341 394 2.6e-4 SMART
EGF_CA 396 438 2.54e-7 SMART
EGF 443 480 1.47e-3 SMART
LamG 505 650 1.75e-9 SMART
EGF 674 707 6.5e-5 SMART
LamG 734 859 1.05e-7 SMART
EGF 889 922 1.19e-3 SMART
LamG 971 1104 6.85e-12 SMART
EGF 1141 1174 7.07e-6 SMART
EGF_CA 1176 1211 3.01e-9 SMART
EGF 1216 1249 3.57e-2 SMART
EGF 1257 1294 6.92e0 SMART
EGF_CA 1296 1332 4.19e-8 SMART
transmembrane domain 1346 1368 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196402
SMART Domains Protein: ENSMUSP00000142702
Gene: ENSMUSG00000063681

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
EGF 72 107 5.97e-4 SMART
EGF 112 145 9.19e-5 SMART
EGF_CA 147 183 2.89e-11 SMART
EGF_CA 185 221 1.14e-9 SMART
EGF_CA 223 259 2.26e-13 SMART
EGF_CA 261 298 5.15e-8 SMART
EGF 303 336 8.12e-6 SMART
EGF 341 394 2.6e-4 SMART
EGF_CA 396 438 2.54e-7 SMART
EGF 443 480 1.47e-3 SMART
LamG 505 650 1.75e-9 SMART
EGF 674 707 6.5e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000198445
AA Change: C823R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142552
Gene: ENSMUSG00000063681
AA Change: C823R

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
EGF 72 107 5.97e-4 SMART
EGF 112 145 9.19e-5 SMART
EGF_CA 147 183 2.89e-11 SMART
EGF_CA 185 221 1.14e-9 SMART
EGF_CA 223 259 2.26e-13 SMART
EGF_CA 261 298 5.15e-8 SMART
EGF 303 333 1.63e1 SMART
EGF_CA 335 377 2.54e-7 SMART
EGF 382 419 1.47e-3 SMART
LamG 444 589 1.75e-9 SMART
EGF 613 646 6.5e-5 SMART
LamG 673 798 1.05e-7 SMART
EGF 828 861 1.19e-3 SMART
LamG 910 1043 6.85e-12 SMART
EGF 1080 1113 7.07e-6 SMART
EGF_CA 1115 1150 3.01e-9 SMART
EGF 1155 1188 3.57e-2 SMART
EGF 1196 1233 6.92e0 SMART
EGF_CA 1235 1271 4.19e-8 SMART
low complexity region 1282 1296 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199291
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype Strain: 3052072; 2676366
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is similar to the Drosophila crumbs protein and localizes to the inner segment of mammalian photoreceptors. In Drosophila crumbs localizes to the stalk of the fly photoreceptor and may be a component of the molecular scaffold that controls proper development of polarity in the eye. Mutations in this gene are associated with a severe form of retinitis pigmentosa, RP12, and with Leber congenital amaurosis. Alternate splicing results in multiple transcript variants, some protein coding and some non-protein coding.[provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygotes for a null allele show focal retinal lesions, loss of adherens junctions between photoreceptors and Muller glia cells, and light-accelerated retinal degeneration. Homozygotes for a spontaneous allele show background-sensitive retinal spotting, photoreceptor dysplasia and degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(4) Spontaneous(1)
 

Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 T C 17: 46,310,151 T978A probably benign Het
Adcy9 A G 16: 4,298,742 L638P probably damaging Het
Adgrf2 A G 17: 42,715,172 probably null Het
Anxa6 T C 11: 54,994,341 I461V probably damaging Het
Arap1 T C 7: 101,394,738 L668P probably damaging Het
B020031M17Rik T C 13: 119,950,082 probably benign Het
Ccdc144b T C 3: 36,010,691 Q511R probably benign Het
Ces2e G T 8: 104,932,995 G498W probably damaging Het
Ehmt1 C T 2: 24,836,457 R772H probably damaging Het
Enpep A G 3: 129,280,938 L721S probably benign Het
Flii T G 11: 60,720,212 I464L probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Ift172 T C 5: 31,261,484 E1162G probably damaging Het
Meioc A G 11: 102,675,831 S758G probably damaging Het
Ndst1 A C 18: 60,713,076 S54A probably benign Het
Ndufaf8 G T 11: 120,099,229 E56* probably null Het
Ndufb7 A G 8: 83,566,901 D28G probably benign Het
Olfr1 T C 11: 73,395,192 M277V possibly damaging Het
Olfr447 A G 6: 42,911,546 I8V probably benign Het
Prkg1 A T 19: 30,592,924 F443I probably damaging Het
Pspc1 C T 14: 56,764,236 R227H probably benign Het
Ptpn21 A G 12: 98,710,890 Y120H probably damaging Het
Runx1t1 A T 4: 13,841,890 probably null Het
Ryr3 T C 2: 112,647,049 D4449G probably benign Het
Sacs C A 14: 61,189,629 A159E probably damaging Het
Slc16a14 T C 1: 84,912,505 I360V possibly damaging Het
Thop1 A G 10: 81,075,559 D93G probably benign Het
Tmem92 A C 11: 94,778,738 M85R probably benign Het
Ttn T C 2: 76,857,673 probably benign Het
Zdhhc5 T C 2: 84,694,375 probably null Het
Zfp335 T C 2: 164,892,394 H1291R probably damaging Het
Zfp957 C T 14: 79,214,056 C101Y probably damaging Het
Other mutations in Crb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Crb1 APN 1 139323245 missense probably benign 0.16
IGL01591:Crb1 APN 1 139237339 missense probably damaging 1.00
IGL01644:Crb1 APN 1 139237630 nonsense probably null
IGL01769:Crb1 APN 1 139337068 missense probably damaging 1.00
IGL02172:Crb1 APN 1 139237227 missense probably damaging 1.00
IGL02294:Crb1 APN 1 139234782 missense possibly damaging 0.89
IGL02382:Crb1 APN 1 139237614 missense probably damaging 0.99
IGL02411:Crb1 APN 1 139248475 missense probably damaging 1.00
IGL03070:Crb1 APN 1 139241258 missense possibly damaging 0.79
IGL02984:Crb1 UTSW 1 139237086 frame shift probably null
IGL02988:Crb1 UTSW 1 139237086 frame shift probably null
IGL02991:Crb1 UTSW 1 139237084 frame shift probably null
IGL02991:Crb1 UTSW 1 139237086 frame shift probably null
IGL03014:Crb1 UTSW 1 139237086 frame shift probably null
IGL03050:Crb1 UTSW 1 139237086 frame shift probably null
IGL03054:Crb1 UTSW 1 139237086 frame shift probably null
IGL03055:Crb1 UTSW 1 139237086 frame shift probably null
IGL03097:Crb1 UTSW 1 139237086 frame shift probably null
IGL03098:Crb1 UTSW 1 139237086 frame shift probably null
IGL03134:Crb1 UTSW 1 139237086 frame shift probably null
IGL03138:Crb1 UTSW 1 139237086 frame shift probably null
IGL03147:Crb1 UTSW 1 139237086 frame shift probably null
P0017:Crb1 UTSW 1 139248940 missense possibly damaging 0.64
R0276:Crb1 UTSW 1 139323335 missense possibly damaging 0.85
R0325:Crb1 UTSW 1 139241166 missense probably damaging 1.00
R0401:Crb1 UTSW 1 139198791 splice site probably benign
R0479:Crb1 UTSW 1 139198614 missense probably damaging 0.98
R0734:Crb1 UTSW 1 139337084 missense probably benign 0.25
R1573:Crb1 UTSW 1 139337606 missense probably damaging 1.00
R1728:Crb1 UTSW 1 139234779 missense probably benign
R1728:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1728:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1728:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1728:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1729:Crb1 UTSW 1 139234779 missense probably benign
R1729:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1729:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1729:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1729:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1730:Crb1 UTSW 1 139234779 missense probably benign
R1730:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1730:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1730:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1730:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1739:Crb1 UTSW 1 139234779 missense probably benign
R1739:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1739:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1739:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1739:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1762:Crb1 UTSW 1 139234779 missense probably benign
R1762:Crb1 UTSW 1 139237531 missense probably damaging 1.00
R1762:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1762:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1762:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1762:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1783:Crb1 UTSW 1 139234779 missense probably benign
R1783:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1783:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1783:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1783:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1784:Crb1 UTSW 1 139234779 missense probably benign
R1784:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1784:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1784:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1784:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1785:Crb1 UTSW 1 139234779 missense probably benign
R1785:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1785:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1785:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1785:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1848:Crb1 UTSW 1 139237012 missense probably damaging 0.97
R1894:Crb1 UTSW 1 139243193 missense probably benign 0.02
R2057:Crb1 UTSW 1 139314750 missense probably damaging 1.00
R2136:Crb1 UTSW 1 139337425 missense probably benign 0.03
R2140:Crb1 UTSW 1 139237012 missense probably benign 0.01
R2363:Crb1 UTSW 1 139337278 missense possibly damaging 0.89
R3605:Crb1 UTSW 1 139237339 missense probably damaging 1.00
R3817:Crb1 UTSW 1 139248097 missense probably benign
R3942:Crb1 UTSW 1 139337473 missense possibly damaging 0.49
R4272:Crb1 UTSW 1 139323311 missense probably benign 0.04
R4301:Crb1 UTSW 1 139248830 missense probably benign 0.01
R4403:Crb1 UTSW 1 139248379 missense probably benign 0.00
R4700:Crb1 UTSW 1 139198771 missense probably damaging 0.96
R4771:Crb1 UTSW 1 139328204 missense probably damaging 1.00
R4845:Crb1 UTSW 1 139243034 missense probably benign 0.06
R4867:Crb1 UTSW 1 139243014 missense probably damaging 1.00
R5159:Crb1 UTSW 1 139243018 missense probably damaging 0.99
R5270:Crb1 UTSW 1 139236864 missense probably damaging 0.97
R5347:Crb1 UTSW 1 139337371 missense probably damaging 1.00
R5513:Crb1 UTSW 1 139236821 critical splice donor site probably null
R5641:Crb1 UTSW 1 139248889 missense probably damaging 0.99
R5754:Crb1 UTSW 1 139231599 missense probably damaging 1.00
R6122:Crb1 UTSW 1 139248948 nonsense probably null
R6369:Crb1 UTSW 1 139237462 missense probably damaging 1.00
R6809:Crb1 UTSW 1 139243126 missense probably benign 0.00
X0066:Crb1 UTSW 1 139248245 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GGTAGGGCATCAGCATTTTG -3'
(R):5'- GTCATCTTCATTGGTGGCTTAC -3'

Sequencing Primer
(F):5'- CAAGTTCAAATCCATTCTGGGC -3'
(R):5'- GGTGGCTTACCTGACAGAG -3'
Posted On2017-03-31