Incidental Mutation 'R5968:Or1e16'
ID 470703
Institutional Source Beutler Lab
Gene Symbol Or1e16
Ensembl Gene ENSMUSG00000069823
Gene Name olfactory receptor family 1 subfamily E member 16
Synonyms GA_x6K02T2P1NL-3556334-3555390, MOR135-13, I54, Olfr1
MMRRC Submission 043249-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R5968 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 73285902-73290321 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 73286018 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 277 (M277V)
Ref Sequence ENSEMBL: ENSMUSP00000113707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120303] [ENSMUST00000131253] [ENSMUST00000134011]
AlphaFold Q8VGI1
Predicted Effect possibly damaging
Transcript: ENSMUST00000120303
AA Change: M277V

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113707
Gene: ENSMUSG00000069823
AA Change: M277V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.7e-60 PFAM
Pfam:7tm_1 41 290 2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131253
SMART Domains Protein: ENSMUSP00000120899
Gene: ENSMUSG00000069823

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 31 184 1.2e-6 PFAM
Pfam:7TM_GPCR_Srsx 35 171 6.1e-8 PFAM
Pfam:7tm_1 41 191 3.6e-30 PFAM
Pfam:7tm_4 139 196 1.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134011
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206193
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 T C 17: 46,621,077 (GRCm39) T978A probably benign Het
Adcy9 A G 16: 4,116,606 (GRCm39) L638P probably damaging Het
Adgrf2 A G 17: 43,026,063 (GRCm39) probably null Het
Anxa6 T C 11: 54,885,167 (GRCm39) I461V probably damaging Het
Arap1 T C 7: 101,043,945 (GRCm39) L668P probably damaging Het
Ces2e G T 8: 105,659,627 (GRCm39) G498W probably damaging Het
Crb1 A G 1: 139,170,739 (GRCm39) C823R probably damaging Het
Ehmt1 C T 2: 24,726,469 (GRCm39) R772H probably damaging Het
Enpep A G 3: 129,074,587 (GRCm39) L721S probably benign Het
Flii T G 11: 60,611,038 (GRCm39) I464L probably benign Het
Gm57858 T C 3: 36,064,840 (GRCm39) Q511R probably benign Het
Gtf2h3 C T 5: 124,722,360 (GRCm39) T121I probably benign Het
Ift172 T C 5: 31,418,828 (GRCm39) E1162G probably damaging Het
Meioc A G 11: 102,566,657 (GRCm39) S758G probably damaging Het
Ndst1 A C 18: 60,846,148 (GRCm39) S54A probably benign Het
Ndufaf8 G T 11: 119,990,055 (GRCm39) E56* probably null Het
Ndufb7 A G 8: 84,293,530 (GRCm39) D28G probably benign Het
Or2a25 A G 6: 42,888,480 (GRCm39) I8V probably benign Het
Prkg1 A T 19: 30,570,324 (GRCm39) F443I probably damaging Het
Pspc1 C T 14: 57,001,693 (GRCm39) R227H probably benign Het
Ptpn21 A G 12: 98,677,149 (GRCm39) Y120H probably damaging Het
Runx1t1 A T 4: 13,841,890 (GRCm39) probably null Het
Ryr3 T C 2: 112,477,394 (GRCm39) D4449G probably benign Het
Sacs C A 14: 61,427,078 (GRCm39) A159E probably damaging Het
Slc16a14 T C 1: 84,890,226 (GRCm39) I360V possibly damaging Het
Tcstv5 T C 13: 120,411,618 (GRCm39) probably benign Het
Thop1 A G 10: 80,911,393 (GRCm39) D93G probably benign Het
Tmem92 A C 11: 94,669,564 (GRCm39) M85R probably benign Het
Ttn T C 2: 76,688,017 (GRCm39) probably benign Het
Zdhhc5 T C 2: 84,524,719 (GRCm39) probably null Het
Zfp335 T C 2: 164,734,314 (GRCm39) H1291R probably damaging Het
Zfp957 C T 14: 79,451,496 (GRCm39) C101Y probably damaging Het
Other mutations in Or1e16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Or1e16 APN 11 73,286,017 (GRCm39) missense probably damaging 0.98
IGL01938:Or1e16 APN 11 73,286,471 (GRCm39) missense probably damaging 1.00
IGL02270:Or1e16 APN 11 73,286,191 (GRCm39) missense probably benign
IGL03287:Or1e16 APN 11 73,286,845 (GRCm39) start codon destroyed probably null 1.00
R0006:Or1e16 UTSW 11 73,286,314 (GRCm39) missense probably damaging 0.99
R0907:Or1e16 UTSW 11 73,285,945 (GRCm39) missense probably damaging 0.97
R1982:Or1e16 UTSW 11 73,285,918 (GRCm39) missense probably benign 0.00
R3804:Or1e16 UTSW 11 73,286,776 (GRCm39) missense probably benign 0.01
R4064:Or1e16 UTSW 11 73,286,348 (GRCm39) missense probably benign 0.04
R4171:Or1e16 UTSW 11 73,286,365 (GRCm39) missense probably damaging 1.00
R4724:Or1e16 UTSW 11 73,285,981 (GRCm39) missense probably damaging 1.00
R4732:Or1e16 UTSW 11 73,286,521 (GRCm39) missense probably benign 0.03
R4733:Or1e16 UTSW 11 73,286,521 (GRCm39) missense probably benign 0.03
R5030:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5097:Or1e16 UTSW 11 73,286,119 (GRCm39) missense probably damaging 1.00
R5098:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5101:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5135:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5137:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5192:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5193:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5193:Or1e16 UTSW 11 73,286,479 (GRCm39) frame shift probably null
R5197:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5220:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5221:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5222:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5258:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5297:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5396:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5398:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5399:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5432:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5433:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5531:Or1e16 UTSW 11 73,286,003 (GRCm39) missense probably benign 0.26
R5634:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5714:Or1e16 UTSW 11 73,286,187 (GRCm39) splice site probably null
R5812:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5813:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5814:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5815:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5913:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5955:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5956:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6029:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6034:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6034:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6176:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6177:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6178:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6196:Or1e16 UTSW 11 73,286,299 (GRCm39) missense probably benign 0.08
R6995:Or1e16 UTSW 11 73,286,410 (GRCm39) missense probably benign
R7035:Or1e16 UTSW 11 73,286,544 (GRCm39) missense probably benign 0.00
R7470:Or1e16 UTSW 11 73,286,714 (GRCm39) missense probably damaging 1.00
R7530:Or1e16 UTSW 11 73,279,189 (GRCm39) missense possibly damaging 0.55
R8461:Or1e16 UTSW 11 73,285,982 (GRCm39) missense probably damaging 1.00
R9149:Or1e16 UTSW 11 73,286,853 (GRCm39) unclassified probably benign
R9279:Or1e16 UTSW 11 73,279,789 (GRCm39) missense probably benign 0.05
R9293:Or1e16 UTSW 11 73,285,955 (GRCm39) missense probably damaging 0.99
R9682:Or1e16 UTSW 11 73,286,025 (GRCm39) missense probably benign 0.03
R9752:Or1e16 UTSW 11 73,286,479 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGTAGGCAATTAGTATGGCTGG -3'
(R):5'- TGTGGCCAGCATCTTTCTTG -3'

Sequencing Primer
(F):5'- CAATTAGTATGGCTGGTGGGC -3'
(R):5'- GCACTCATTACCATGTCCTATGTAAG -3'
Posted On 2017-03-31