Incidental Mutation 'R5427:Cryab'
ID475519
Institutional Source Beutler Lab
Gene Symbol Cryab
Ensembl Gene ENSMUSG00000032060
Gene Namecrystallin, alpha B
SynonymsCrya2, alpha B-crystallin, HspB5, Crya-2
MMRRC Submission 042993-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.359) question?
Stock #R5427 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location50751325-50756636 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50756293 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 109 (D109G)
Ref Sequence ENSEMBL: ENSMUSP00000149454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034562] [ENSMUST00000042790] [ENSMUST00000214609] [ENSMUST00000214962] [ENSMUST00000216755] [ENSMUST00000217159] [ENSMUST00000217475]
Predicted Effect probably damaging
Transcript: ENSMUST00000034562
AA Change: D109G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034562
Gene: ENSMUSG00000032060
AA Change: D109G

DomainStartEndE-ValueType
Pfam:Crystallin 1 56 7.3e-32 PFAM
Pfam:HSP20 67 162 2.1e-27 PFAM
low complexity region 166 175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042790
SMART Domains Protein: ENSMUSP00000042374
Gene: ENSMUSG00000038086

DomainStartEndE-ValueType
Pfam:Crystallin 14 55 1.6e-8 PFAM
Pfam:HSP20 66 163 5.7e-19 PFAM
low complexity region 166 182 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214609
AA Change: D109G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214962
AA Change: D109G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216393
Predicted Effect probably damaging
Transcript: ENSMUST00000216755
AA Change: D109G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000217159
Predicted Effect probably damaging
Transcript: ENSMUST00000217475
AA Change: D109G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.352 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: This gene encodes a member of the small heat-shock protein (HSP20) family. The encoded protein is a molecular chaperone that protects proteins against thermal denaturation and other stresses. This protein is a component of the eye lens, regulates lens differentiation and functions as a refractive element in the lens. This protein is a negative regulator of inflammation, has anti-apoptotic properties and also plays a role in the formation of muscular tissue. Mice lacking this gene exhibit worse experimental autoimmune encephalomyelitis and inflammation of the central nervous system compared to the wild type. In mouse models, this gene has a critical role in alleviating the pathology of the neurodegenerative Alexander disease. Mutations in the human gene are associated with myofibrillar myopathy 2, fatal infantile hypertonic myofibrillar myopathy, multiple types of cataract and dilated cardiomyopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous or heterozygous for a knock-in allele exhibit decreased grip strength and develop cataracts and myopathy; some mice display unilateral corneal abnormalities and small eyes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,352,596 C128Y probably benign Het
Aaas A G 15: 102,339,950 V277A possibly damaging Het
Adcy7 G A 8: 88,326,201 probably null Het
Adgrg5 A T 8: 94,935,102 D157V probably benign Het
Akap13 A G 7: 75,728,869 N2090S possibly damaging Het
Alpi T C 1: 87,101,354 N33D probably benign Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Anp32a A G 9: 62,377,316 probably benign Het
Atg4b G C 1: 93,775,206 K86N probably damaging Het
Bbx T C 16: 50,280,497 T12A probably benign Het
Catsperg2 T C 7: 29,714,850 T377A possibly damaging Het
Ccdc158 T C 5: 92,648,962 Q505R probably damaging Het
Cep135 T A 5: 76,638,202 S1051T probably benign Het
Crym A C 7: 120,199,222 probably benign Het
Csf2rb2 T A 15: 78,288,911 S250C probably damaging Het
Diaph1 A T 18: 37,890,595 V730E unknown Het
Eci3 G T 13: 34,959,948 L65M possibly damaging Het
Erg28 T C 12: 85,819,567 N46D probably damaging Het
Fam89b A G 19: 5,728,791 S127P probably benign Het
Fign A G 2: 63,978,998 Y643H probably damaging Het
Galk2 T C 2: 125,946,821 V265A probably benign Het
Gclm T C 3: 122,266,327 V252A probably damaging Het
Git2 A G 5: 114,730,328 S584P possibly damaging Het
Gm38394 A G 1: 133,657,595 V668A possibly damaging Het
Iqcf3 T C 9: 106,543,860 probably null Het
Kcnk3 A G 5: 30,622,295 T230A possibly damaging Het
Myh10 T C 11: 68,802,931 L1486P probably damaging Het
Myom2 C A 8: 15,113,764 A1006E probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nampt A T 12: 32,834,915 H111L probably benign Het
Nid1 A G 13: 13,483,683 Y671C probably damaging Het
Npy5r G A 8: 66,681,020 R374C probably damaging Het
Olfr1116 A T 2: 87,269,514 K244N probably benign Het
Olfr1487 A T 19: 13,619,350 S20C probably benign Het
Palld C T 8: 61,550,072 C720Y probably benign Het
Pcsk6 C T 7: 66,033,899 T606M probably benign Het
Pfas T C 11: 69,001,153 I176M possibly damaging Het
Pi4kb A G 3: 94,994,207 D395G probably benign Het
Plod3 A T 5: 136,991,788 Y547F probably damaging Het
Pnpo T C 11: 96,943,807 Y21C probably benign Het
Rgs1 A T 1: 144,246,280 C118* probably null Het
Rrnad1 T C 3: 87,924,332 probably benign Het
Slc22a27 A G 19: 7,879,388 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sppl2c G A 11: 104,187,867 V498I probably benign Het
Stim2 A T 5: 54,110,939 I448F possibly damaging Het
Sulf1 A T 1: 12,796,912 T107S possibly damaging Het
Tenm3 A G 8: 48,236,564 V1996A probably damaging Het
Timm23 G A 14: 32,189,146 T171I possibly damaging Het
Tssk2 A G 16: 17,898,865 D44G probably damaging Het
Vmn2r28 A T 7: 5,486,377 Y488N probably damaging Het
Zbtb48 A G 4: 152,020,651 F518S probably damaging Het
Zfp709 A G 8: 71,889,132 E135G probably benign Het
Zfp788 G A 7: 41,649,652 V571I possibly damaging Het
Zfp963 A G 8: 69,743,456 S116P probably benign Het
Other mutations in Cryab
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01073:Cryab APN 9 50754555 missense probably damaging 1.00
R3029:Cryab UTSW 9 50756338 missense probably damaging 0.98
R4999:Cryab UTSW 9 50754609 missense possibly damaging 0.92
R5355:Cryab UTSW 9 50753451 missense probably damaging 1.00
R6192:Cryab UTSW 9 50754513 missense probably damaging 0.97
R6272:Cryab UTSW 9 50754525 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CTTAAACCTGGACAAACAGCTCTAG -3'
(R):5'- GCTTCTCTTCACGGGTGATG -3'

Sequencing Primer
(F):5'- TGGACAAACAGCTCTAGACTTAG -3'
(R):5'- ATGGGAATGGTGCGCTCAG -3'
Posted On2017-05-11