Incidental Mutation 'R6081:Mcm8'
ID 482911
Institutional Source Beutler Lab
Gene Symbol Mcm8
Ensembl Gene ENSMUSG00000027353
Gene Name minichromosome maintenance 8 homologous recombination repair factor
Synonyms 5730432L01Rik
MMRRC Submission 044240-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.731) question?
Stock # R6081 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 132658061-132686117 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 132670003 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 359 (R359L)
Ref Sequence ENSEMBL: ENSMUSP00000066842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028831] [ENSMUST00000066559]
AlphaFold Q9CWV1
Predicted Effect probably benign
Transcript: ENSMUST00000028831
AA Change: R387L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000028831
Gene: ENSMUSG00000027353
AA Change: R387L

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
Blast:MCM 79 155 2e-28 BLAST
MCM 198 742 2.42e-136 SMART
AAA 439 590 5.99e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066559
AA Change: R359L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000066842
Gene: ENSMUSG00000027353
AA Change: R359L

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Blast:MCM 51 127 2e-28 BLAST
MCM 170 714 2.42e-136 SMART
AAA 411 562 5.99e-6 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by the mini-chromosome maintenance proteins is a key component of the pre-replication complex and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein contains the central domain that is conserved among the mini-chromosome maintenance proteins. The encoded protein may interact with other mini-chromosome maintenance proteins and play a role in DNA replication. This gene may be associated with length of reproductive lifespan and menopause. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female and male infertility associated with impaired ovarian development and arrested male meiosis, and impaired sensitivity to homologous recombination double-strand break repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,887,097 (GRCm39) M33K probably damaging Het
4930556J24Rik T C 11: 3,888,140 (GRCm39) Q82R unknown Het
Adcy9 T C 16: 4,112,545 (GRCm39) D714G probably benign Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Ahctf1 G T 1: 179,609,237 (GRCm39) A639E probably benign Het
Ank3 G A 10: 69,838,395 (GRCm39) R1566K possibly damaging Het
Anxa5 C T 3: 36,519,436 (GRCm39) D18N probably damaging Het
Apc C T 18: 34,423,164 (GRCm39) P299L possibly damaging Het
Btnl4 C A 17: 34,693,210 (GRCm39) W68C probably damaging Het
Cmya5 T A 13: 93,281,021 (GRCm39) probably benign Het
Cstf2t G T 19: 31,060,523 (GRCm39) V20L probably benign Het
D630045J12Rik A T 6: 38,119,633 (GRCm39) V1703E probably damaging Het
Dhx32 A G 7: 133,323,941 (GRCm39) F535S probably damaging Het
Diras2 T C 13: 52,662,181 (GRCm39) D42G probably damaging Het
Dppa3 T A 6: 122,606,931 (GRCm39) D140E probably damaging Het
Gpr180 C T 14: 118,391,086 (GRCm39) T205I probably benign Het
Gzme T G 14: 56,355,764 (GRCm39) T183P possibly damaging Het
H2-T23 T A 17: 36,342,707 (GRCm39) I144F possibly damaging Het
Hlx T C 1: 184,459,894 (GRCm39) S415G probably benign Het
Krtap5-3 G A 7: 141,755,223 (GRCm39) C20Y unknown Het
Mroh2b G C 15: 4,973,859 (GRCm39) E1126Q probably damaging Het
Nav1 C T 1: 135,398,560 (GRCm39) R674H probably damaging Het
Otx1 A T 11: 21,949,406 (GRCm39) L24H probably damaging Het
Rnaset2b T A 17: 7,256,193 (GRCm39) probably null Het
Samd12 T C 15: 53,583,074 (GRCm39) K87E probably benign Het
Sec16b T C 1: 157,388,324 (GRCm39) S564P probably benign Het
Speer4a1 A T 5: 26,239,960 (GRCm39) C263* probably null Het
Susd1 C A 4: 59,411,359 (GRCm39) C158F possibly damaging Het
Vmn2r6 C T 3: 64,463,953 (GRCm39) V294M probably benign Het
Other mutations in Mcm8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Mcm8 APN 2 132,669,457 (GRCm39) missense probably benign
IGL00479:Mcm8 APN 2 132,659,094 (GRCm39) missense probably benign
IGL00573:Mcm8 APN 2 132,674,732 (GRCm39) missense possibly damaging 0.94
IGL00847:Mcm8 APN 2 132,661,594 (GRCm39) missense probably benign 0.29
IGL00978:Mcm8 APN 2 132,663,326 (GRCm39) missense probably benign
IGL01390:Mcm8 APN 2 132,679,998 (GRCm39) splice site probably benign
IGL01785:Mcm8 APN 2 132,669,868 (GRCm39) missense probably benign 0.05
IGL01786:Mcm8 APN 2 132,669,868 (GRCm39) missense probably benign 0.05
IGL02216:Mcm8 APN 2 132,681,449 (GRCm39) missense probably damaging 1.00
IGL03191:Mcm8 APN 2 132,663,362 (GRCm39) missense possibly damaging 0.68
madamina UTSW 2 132,674,774 (GRCm39) missense probably damaging 1.00
PIT4687001:Mcm8 UTSW 2 132,659,097 (GRCm39) missense possibly damaging 0.54
R0329:Mcm8 UTSW 2 132,661,914 (GRCm39) missense possibly damaging 0.64
R0330:Mcm8 UTSW 2 132,661,914 (GRCm39) missense possibly damaging 0.64
R1520:Mcm8 UTSW 2 132,681,375 (GRCm39) missense probably benign 0.39
R1771:Mcm8 UTSW 2 132,685,476 (GRCm39) nonsense probably null
R1967:Mcm8 UTSW 2 132,684,662 (GRCm39) missense probably benign
R2228:Mcm8 UTSW 2 132,662,041 (GRCm39) missense possibly damaging 0.85
R2418:Mcm8 UTSW 2 132,666,658 (GRCm39) missense probably benign
R4728:Mcm8 UTSW 2 132,674,774 (GRCm39) missense probably damaging 1.00
R4827:Mcm8 UTSW 2 132,665,174 (GRCm39) missense probably damaging 0.99
R4847:Mcm8 UTSW 2 132,661,923 (GRCm39) missense probably benign 0.01
R4928:Mcm8 UTSW 2 132,681,399 (GRCm39) missense probably benign 0.00
R4932:Mcm8 UTSW 2 132,680,629 (GRCm39) missense probably benign 0.09
R4962:Mcm8 UTSW 2 132,680,689 (GRCm39) missense probably damaging 1.00
R6044:Mcm8 UTSW 2 132,673,600 (GRCm39) critical splice donor site probably null
R6650:Mcm8 UTSW 2 132,663,327 (GRCm39) missense probably benign 0.01
R6685:Mcm8 UTSW 2 132,684,570 (GRCm39) missense probably damaging 1.00
R7006:Mcm8 UTSW 2 132,665,181 (GRCm39) missense probably damaging 1.00
R7176:Mcm8 UTSW 2 132,661,992 (GRCm39) missense probably benign 0.01
R7328:Mcm8 UTSW 2 132,674,777 (GRCm39) missense probably benign 0.28
R7486:Mcm8 UTSW 2 132,681,440 (GRCm39) missense probably damaging 1.00
R7631:Mcm8 UTSW 2 132,669,963 (GRCm39) missense not run
R7664:Mcm8 UTSW 2 132,685,453 (GRCm39) missense probably damaging 0.96
R7820:Mcm8 UTSW 2 132,682,692 (GRCm39) missense possibly damaging 0.68
R8090:Mcm8 UTSW 2 132,673,569 (GRCm39) missense probably benign 0.30
R8228:Mcm8 UTSW 2 132,684,714 (GRCm39) critical splice donor site probably null
R8738:Mcm8 UTSW 2 132,665,141 (GRCm39) missense probably benign
Z1176:Mcm8 UTSW 2 132,669,487 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGGGAATTCCTTGTTCATTATGTG -3'
(R):5'- AAACACCCATTGCCAAGTGG -3'

Sequencing Primer
(F):5'- GCTCAGGCTTGAAATTGCAC -3'
(R):5'- AACTCCTATACGTGCCTGAAGGTG -3'
Posted On 2017-07-14