Incidental Mutation 'R6081:Mcm8'
ID482911
Institutional Source Beutler Lab
Gene Symbol Mcm8
Ensembl Gene ENSMUSG00000027353
Gene Nameminichromosome maintenance 8 homologous recombination repair factor
Synonyms5730432L01Rik
MMRRC Submission 044240-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.654) question?
Stock #R6081 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location132816141-132844197 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 132828083 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 359 (R359L)
Ref Sequence ENSEMBL: ENSMUSP00000066842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028831] [ENSMUST00000066559]
Predicted Effect probably benign
Transcript: ENSMUST00000028831
AA Change: R387L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000028831
Gene: ENSMUSG00000027353
AA Change: R387L

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
Blast:MCM 79 155 2e-28 BLAST
MCM 198 742 2.42e-136 SMART
AAA 439 590 5.99e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066559
AA Change: R359L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000066842
Gene: ENSMUSG00000027353
AA Change: R359L

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Blast:MCM 51 127 2e-28 BLAST
MCM 170 714 2.42e-136 SMART
AAA 411 562 5.99e-6 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by the mini-chromosome maintenance proteins is a key component of the pre-replication complex and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein contains the central domain that is conserved among the mini-chromosome maintenance proteins. The encoded protein may interact with other mini-chromosome maintenance proteins and play a role in DNA replication. This gene may be associated with length of reproductive lifespan and menopause. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female and male infertility associated with impaired ovarian development and arrested male meiosis, and impaired sensitivity to homologous recombination double-strand break repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,739,231 M33K probably damaging Het
4930556J24Rik T C 11: 3,938,140 Q82R unknown Het
Adcy9 T C 16: 4,294,681 D714G probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ahctf1 G T 1: 179,781,672 A639E probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Anxa5 C T 3: 36,465,287 D18N probably damaging Het
Apc C T 18: 34,290,111 P299L possibly damaging Het
Btnl4 C A 17: 34,474,236 W68C probably damaging Het
Cmya5 T A 13: 93,144,513 probably benign Het
Cstf2t G T 19: 31,083,123 V20L probably benign Het
D630045J12Rik A T 6: 38,142,698 V1703E probably damaging Het
Dhx32 A G 7: 133,722,212 F535S probably damaging Het
Diras2 T C 13: 52,508,145 D42G probably damaging Het
Dppa3 T A 6: 122,629,972 D140E probably damaging Het
Gpr180 C T 14: 118,153,674 T205I probably benign Het
Gzme T G 14: 56,118,307 T183P possibly damaging Het
H2-T23 T A 17: 36,031,815 I144F possibly damaging Het
Hlx T C 1: 184,727,697 S415G probably benign Het
Krtap5-3 G A 7: 142,201,486 C20Y unknown Het
Mroh2b G C 15: 4,944,377 E1126Q probably damaging Het
Nav1 C T 1: 135,470,822 R674H probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Rnaset2b T A 17: 6,988,794 probably null Het
Samd12 T C 15: 53,719,678 K87E probably benign Het
Sec16b T C 1: 157,560,754 S564P probably benign Het
Speer4a A T 5: 26,034,962 C263* probably null Het
Susd1 C A 4: 59,411,359 C158F possibly damaging Het
Vmn2r6 C T 3: 64,556,532 V294M probably benign Het
Other mutations in Mcm8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Mcm8 APN 2 132827537 missense probably benign
IGL00479:Mcm8 APN 2 132817174 missense probably benign
IGL00573:Mcm8 APN 2 132832812 missense possibly damaging 0.94
IGL00847:Mcm8 APN 2 132819674 missense probably benign 0.29
IGL00978:Mcm8 APN 2 132821406 missense probably benign
IGL01390:Mcm8 APN 2 132838078 splice site probably benign
IGL01785:Mcm8 APN 2 132827948 missense probably benign 0.05
IGL01786:Mcm8 APN 2 132827948 missense probably benign 0.05
IGL02216:Mcm8 APN 2 132839529 missense probably damaging 1.00
IGL03191:Mcm8 APN 2 132821442 missense possibly damaging 0.68
madamina UTSW 2 132832854 missense probably damaging 1.00
PIT4687001:Mcm8 UTSW 2 132817177 missense possibly damaging 0.54
R0329:Mcm8 UTSW 2 132819994 missense possibly damaging 0.64
R0330:Mcm8 UTSW 2 132819994 missense possibly damaging 0.64
R1520:Mcm8 UTSW 2 132839455 missense probably benign 0.39
R1771:Mcm8 UTSW 2 132843556 nonsense probably null
R1967:Mcm8 UTSW 2 132842742 missense probably benign
R2228:Mcm8 UTSW 2 132820121 missense possibly damaging 0.85
R2418:Mcm8 UTSW 2 132824738 missense probably benign
R4728:Mcm8 UTSW 2 132832854 missense probably damaging 1.00
R4827:Mcm8 UTSW 2 132823254 missense probably damaging 0.99
R4847:Mcm8 UTSW 2 132820003 missense probably benign 0.01
R4928:Mcm8 UTSW 2 132839479 missense probably benign 0.00
R4932:Mcm8 UTSW 2 132838709 missense probably benign 0.09
R4962:Mcm8 UTSW 2 132838769 missense probably damaging 1.00
R6044:Mcm8 UTSW 2 132831680 critical splice donor site probably null
R6650:Mcm8 UTSW 2 132821407 missense probably benign 0.01
R6685:Mcm8 UTSW 2 132842650 missense probably damaging 1.00
R7006:Mcm8 UTSW 2 132823261 missense probably damaging 1.00
R7176:Mcm8 UTSW 2 132820072 missense probably benign 0.01
R7328:Mcm8 UTSW 2 132832857 missense probably benign 0.28
R7486:Mcm8 UTSW 2 132839520 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGGAATTCCTTGTTCATTATGTG -3'
(R):5'- AAACACCCATTGCCAAGTGG -3'

Sequencing Primer
(F):5'- GCTCAGGCTTGAAATTGCAC -3'
(R):5'- AACTCCTATACGTGCCTGAAGGTG -3'
Posted On2017-07-14