Incidental Mutation 'R0532:Fry'
ID49235
Institutional Source Beutler Lab
Gene Symbol Fry
Ensembl Gene ENSMUSG00000056602
Gene NameFRY microtubule binding protein
Synonyms9330186A19Rik, cg003
MMRRC Submission 038724-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.733) question?
Stock #R0532 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location150118645-150497753 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 150433707 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087204] [ENSMUST00000202566]
Predicted Effect probably benign
Transcript: ENSMUST00000087204
SMART Domains Protein: ENSMUSP00000084454
Gene: ENSMUSG00000056602

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 165 697 5.3e-170 PFAM
low complexity region 1014 1040 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1188 1380 1.2e-15 PFAM
Pfam:MOR2-PAG1_mid 1398 1534 1.5e-5 PFAM
Pfam:MOR2-PAG1_mid 1632 1704 1.8e-7 PFAM
Pfam:MOR2-PAG1_mid 1772 1906 4.9e-10 PFAM
low complexity region 1936 1956 N/A INTRINSIC
low complexity region 1962 1980 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2050 2303 1.9e-74 PFAM
low complexity region 2369 2385 N/A INTRINSIC
low complexity region 2463 2482 N/A INTRINSIC
low complexity region 2525 2534 N/A INTRINSIC
low complexity region 2836 2852 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201634
Predicted Effect probably benign
Transcript: ENSMUST00000202566
SMART Domains Protein: ENSMUSP00000144657
Gene: ENSMUSG00000056602

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_C 37 290 1.5e-71 PFAM
low complexity region 356 372 N/A INTRINSIC
low complexity region 447 472 N/A INTRINSIC
low complexity region 515 524 N/A INTRINSIC
low complexity region 832 848 N/A INTRINSIC
Meta Mutation Damage Score 0.0556 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 100% (90/90)
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A T 18: 6,638,618 E339V possibly damaging Het
9230009I02Rik A T 11: 51,091,578 noncoding transcript Het
9230112D13Rik A T 14: 34,512,097 I79K unknown Het
Adam25 C T 8: 40,755,950 T751I probably benign Het
Adgrv1 C A 13: 81,578,896 V446L probably damaging Het
Afap1 C A 5: 35,968,600 A313D possibly damaging Het
Akap6 A G 12: 52,887,983 T753A probably benign Het
Aldh16a1 G T 7: 45,142,838 T730N probably damaging Het
Amfr A T 8: 93,999,108 M215K probably damaging Het
Apob A G 12: 8,016,188 R4386G possibly damaging Het
Arhgap45 A T 10: 80,022,083 M217L possibly damaging Het
Baiap2l2 C T 15: 79,284,076 E49K possibly damaging Het
Baz1a C T 12: 54,934,820 E350K possibly damaging Het
Bbx A T 16: 50,266,284 V83D probably damaging Het
Btaf1 T C 19: 36,951,186 probably benign Het
Cacna2d1 G A 5: 16,362,273 E942K probably benign Het
Cad T C 5: 31,062,187 probably benign Het
Ccdc96 A G 5: 36,486,366 K572R probably benign Het
Cdc5l G A 17: 45,415,684 R321W probably damaging Het
Cep164 G A 9: 45,809,826 R93* probably null Het
Cir1 A G 2: 73,310,455 probably null Het
Crocc A G 4: 141,030,247 S912P possibly damaging Het
Cwf19l2 T C 9: 3,431,057 L463P probably benign Het
Cyp3a59 C T 5: 146,096,653 Q200* probably null Het
Cyp4b1 G T 4: 115,626,876 P303T probably damaging Het
Dcbld1 C A 10: 52,317,077 T306K probably benign Het
Dgat2 A G 7: 99,169,781 V56A possibly damaging Het
Dnajc16 A C 4: 141,789,009 L16R probably damaging Het
Dnmt1 A C 9: 20,918,556 probably benign Het
Dus3l A G 17: 56,769,308 I528V probably damaging Het
Egflam T C 15: 7,234,237 D744G probably benign Het
Epb41 A C 4: 131,978,795 probably benign Het
Eri2 C T 7: 119,785,983 V432I probably benign Het
Esyt2 A G 12: 116,357,198 probably benign Het
Extl3 A T 14: 65,077,673 M20K probably benign Het
Fam32a A G 8: 72,222,219 Y103C probably damaging Het
Fat4 T C 3: 38,981,721 V3174A probably benign Het
Fbxo40 T A 16: 36,969,622 E375D possibly damaging Het
Frrs1 A G 3: 116,883,164 T182A probably benign Het
Fsip2 A G 2: 82,977,785 I1483V probably benign Het
Glra3 T A 8: 56,125,076 D389E probably benign Het
Gpr3 A T 4: 133,210,485 I292N probably damaging Het
Grina T C 15: 76,248,845 M230T probably damaging Het
Igkv11-125 G A 6: 67,913,619 W16* probably null Het
Il18r1 T C 1: 40,474,901 V89A probably damaging Het
Ino80 T C 2: 119,381,983 E1286G possibly damaging Het
Iqch G A 9: 63,508,232 probably benign Het
Itpr2 G T 6: 146,112,400 Q2666K probably damaging Het
Kcnh3 A G 15: 99,232,963 D487G probably damaging Het
Kdm1a A G 4: 136,561,066 L402P probably damaging Het
Klhl10 T G 11: 100,447,111 probably benign Het
Krt39 T C 11: 99,514,791 T428A possibly damaging Het
Mapk3 G A 7: 126,763,386 probably benign Het
Med13l T A 5: 118,759,123 S2089T possibly damaging Het
Mex3c G A 18: 73,590,053 D406N possibly damaging Het
Mki67 G A 7: 135,698,164 R1714* probably null Het
Mmp9 C A 2: 164,949,820 S211* probably null Het
Nat8f2 G T 6: 85,867,802 Q193K probably benign Het
Olfr1333 T G 4: 118,829,700 T247P probably damaging Het
Olfr204 T C 16: 59,314,601 K269E probably benign Het
Omt2a C A 9: 78,312,905 A71S possibly damaging Het
Pdgfra G A 5: 75,170,773 V315I probably benign Het
Pdgfrb A G 18: 61,083,265 D1065G probably damaging Het
Pfas A T 11: 69,002,629 probably benign Het
Pramel5 T C 4: 144,272,740 E259G probably benign Het
Prpf6 A G 2: 181,622,211 Y222C possibly damaging Het
Rbck1 C A 2: 152,324,330 Q229H probably damaging Het
Rdm1 T A 11: 101,635,835 C278S probably benign Het
Sall1 T C 8: 89,033,191 D95G probably benign Het
Scn1a T A 2: 66,317,823 D1126V probably damaging Het
Scn4a C T 11: 106,330,400 G811D probably benign Het
Sh2b1 A G 7: 126,472,272 I247T probably benign Het
Shprh C A 10: 11,162,812 T437K possibly damaging Het
Slc13a4 A T 6: 35,287,404 probably null Het
Slc16a1 C A 3: 104,653,418 Y346* probably null Het
Slc25a38 G T 9: 120,120,706 A163S probably damaging Het
Slc6a12 G A 6: 121,356,918 V238I probably damaging Het
Slc8b1 C A 5: 120,519,671 D66E probably damaging Het
Snapin A G 3: 90,489,586 L106P probably damaging Het
Tas2r122 G A 6: 132,711,828 S34F possibly damaging Het
Tiam2 A G 17: 3,421,646 K521R probably damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Ttc3 T C 16: 94,387,330 probably benign Het
Uba1y T C Y: 820,911 F31L probably benign Het
Ucp3 A G 7: 100,481,979 probably benign Het
Vcan T C 13: 89,703,772 E1023G probably damaging Het
Vmn2r45 A G 7: 8,471,821 I736T probably damaging Het
Vps36 T C 8: 22,218,245 F342L probably benign Het
Zc3hc1 A G 6: 30,374,930 probably benign Het
Zmym4 G A 4: 126,898,401 Q596* probably null Het
Other mutations in Fry
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Fry APN 5 150340404 nonsense probably null
IGL00328:Fry APN 5 150340404 nonsense probably null
IGL00841:Fry APN 5 150422724 missense probably benign
IGL00938:Fry APN 5 150370180 missense probably damaging 1.00
IGL01015:Fry APN 5 150422787 missense probably benign 0.18
IGL01401:Fry APN 5 150438788 missense probably benign
IGL01616:Fry APN 5 150399599 missense probably damaging 1.00
IGL01616:Fry APN 5 150438811 splice site probably null
IGL01748:Fry APN 5 150345651 splice site probably benign
IGL01965:Fry APN 5 150381621 missense probably damaging 1.00
IGL02030:Fry APN 5 150471618 splice site probably benign
IGL02079:Fry APN 5 150399624 missense probably damaging 0.97
IGL02087:Fry APN 5 150403594 missense probably benign 0.23
IGL02113:Fry APN 5 150399605 missense probably benign
IGL02209:Fry APN 5 150437026 missense probably benign 0.00
IGL02250:Fry APN 5 150403434 splice site probably benign
IGL02265:Fry APN 5 150437153 missense probably damaging 1.00
IGL02486:Fry APN 5 150491177 missense probably damaging 0.99
IGL02552:Fry APN 5 150380910 missense probably damaging 1.00
IGL02881:Fry APN 5 150359051 missense probably damaging 0.99
IGL03008:Fry APN 5 150345556 missense possibly damaging 0.82
IGL03140:Fry APN 5 150495701 missense probably damaging 0.98
IGL03171:Fry APN 5 150380809 missense probably damaging 1.00
IGL03389:Fry APN 5 150394231 missense probably damaging 1.00
IGL03404:Fry APN 5 150326168 missense probably damaging 1.00
R0023:Fry UTSW 5 150451098 missense possibly damaging 0.78
R0024:Fry UTSW 5 150380803 missense probably benign 0.03
R0030:Fry UTSW 5 150372569 nonsense probably null
R0053:Fry UTSW 5 150461377 splice site probably benign
R0089:Fry UTSW 5 150340427 missense possibly damaging 0.91
R0212:Fry UTSW 5 150496397 missense probably damaging 0.99
R0241:Fry UTSW 5 150260346 intron probably benign
R0265:Fry UTSW 5 150434776 missense probably damaging 1.00
R0317:Fry UTSW 5 150471468 missense probably damaging 1.00
R0532:Fry UTSW 5 150478761 splice site probably benign
R0599:Fry UTSW 5 150437159 missense probably damaging 0.99
R0631:Fry UTSW 5 150496352 missense possibly damaging 0.82
R0723:Fry UTSW 5 150496360 missense probably damaging 1.00
R0766:Fry UTSW 5 150403432 splice site probably benign
R0790:Fry UTSW 5 150466437 missense probably benign 0.06
R0928:Fry UTSW 5 150437084 missense probably damaging 1.00
R1104:Fry UTSW 5 150496289 missense probably damaging 1.00
R1144:Fry UTSW 5 150418464 missense possibly damaging 0.94
R1172:Fry UTSW 5 150481494 nonsense probably null
R1312:Fry UTSW 5 150403432 splice site probably benign
R1347:Fry UTSW 5 150495818 missense probably damaging 1.00
R1347:Fry UTSW 5 150495818 missense probably damaging 1.00
R1437:Fry UTSW 5 150310425 missense possibly damaging 0.92
R1458:Fry UTSW 5 150380859 missense probably damaging 1.00
R1542:Fry UTSW 5 150404966 missense probably benign 0.13
R1692:Fry UTSW 5 150370227 missense probably damaging 1.00
R1826:Fry UTSW 5 150436709 missense possibly damaging 0.82
R1874:Fry UTSW 5 150345921 missense probably damaging 1.00
R1875:Fry UTSW 5 150326132 missense probably damaging 1.00
R1881:Fry UTSW 5 150478046 missense probably damaging 0.97
R1884:Fry UTSW 5 150403520 missense probably benign 0.00
R1929:Fry UTSW 5 150400924 missense probably null 0.02
R2066:Fry UTSW 5 150370119 splice site probably benign
R2270:Fry UTSW 5 150400924 missense probably null 0.02
R2356:Fry UTSW 5 150471432 missense probably benign
R3720:Fry UTSW 5 150454572 missense probably damaging 1.00
R3773:Fry UTSW 5 150398198 missense probably damaging 0.96
R3824:Fry UTSW 5 150496419 missense possibly damaging 0.94
R3902:Fry UTSW 5 150345927 missense probably damaging 1.00
R3923:Fry UTSW 5 150413349 missense probably benign
R4250:Fry UTSW 5 150310360 missense probably damaging 0.99
R4332:Fry UTSW 5 150381663 missense probably damaging 1.00
R4495:Fry UTSW 5 150310463 missense probably damaging 1.00
R4610:Fry UTSW 5 150386104 missense probably damaging 1.00
R4682:Fry UTSW 5 150422754 missense probably damaging 1.00
R4732:Fry UTSW 5 150386007 missense possibly damaging 0.93
R4733:Fry UTSW 5 150386007 missense possibly damaging 0.93
R4755:Fry UTSW 5 150398254 missense probably damaging 0.99
R4788:Fry UTSW 5 150399636 missense probably benign 0.00
R4803:Fry UTSW 5 150399533 missense probably benign 0.31
R4858:Fry UTSW 5 150401643 missense possibly damaging 0.78
R4872:Fry UTSW 5 150394239 critical splice donor site probably null
R4902:Fry UTSW 5 150495703 missense probably benign 0.43
R4915:Fry UTSW 5 150478863 missense probably benign 0.30
R4938:Fry UTSW 5 150477989 missense probably damaging 1.00
R4983:Fry UTSW 5 150398254 missense probably damaging 1.00
R5004:Fry UTSW 5 150433604 missense probably benign 0.16
R5040:Fry UTSW 5 150388854 missense probably damaging 0.99
R5145:Fry UTSW 5 150370224 missense probably damaging 0.98
R5170:Fry UTSW 5 150429854 missense probably benign 0.03
R5233:Fry UTSW 5 150469720 missense possibly damaging 0.71
R5428:Fry UTSW 5 150405359 missense possibly damaging 0.89
R5468:Fry UTSW 5 150399588 missense probably benign 0.44
R5481:Fry UTSW 5 150260319 missense probably benign 0.01
R5494:Fry UTSW 5 150390667 missense probably damaging 1.00
R5538:Fry UTSW 5 150495848 missense probably damaging 1.00
R5638:Fry UTSW 5 150359081 missense possibly damaging 0.46
R5645:Fry UTSW 5 150380867 missense probably damaging 1.00
R5716:Fry UTSW 5 150370221 nonsense probably null
R5812:Fry UTSW 5 150399671 missense probably damaging 0.99
R5813:Fry UTSW 5 150399671 missense probably damaging 0.99
R5873:Fry UTSW 5 150378885 missense probably damaging 1.00
R5933:Fry UTSW 5 150390800 intron probably benign
R6037:Fry UTSW 5 150428179 missense probably benign 0.03
R6037:Fry UTSW 5 150428179 missense probably benign 0.03
R6158:Fry UTSW 5 150454572 missense probably damaging 1.00
R6178:Fry UTSW 5 150454522 missense probably damaging 1.00
R6481:Fry UTSW 5 150386014 missense probably damaging 1.00
R6562:Fry UTSW 5 150326149 missense probably damaging 1.00
R6676:Fry UTSW 5 150380922 missense probably benign 0.22
R6717:Fry UTSW 5 150496312 missense probably benign 0.00
R6828:Fry UTSW 5 150466446 splice site probably null
R6874:Fry UTSW 5 150437303 missense probably benign 0.00
R6930:Fry UTSW 5 150428230 missense probably benign 0.00
R6963:Fry UTSW 5 150457844 missense probably benign 0.17
R6965:Fry UTSW 5 150416220 missense possibly damaging 0.79
R7051:Fry UTSW 5 150395169 missense possibly damaging 0.93
R7085:Fry UTSW 5 150438749 missense probably benign 0.02
R7108:Fry UTSW 5 150395786 missense probably damaging 1.00
R7108:Fry UTSW 5 150491090 missense
R7115:Fry UTSW 5 150386067 missense probably damaging 1.00
R7116:Fry UTSW 5 150395869 critical splice donor site probably null
R7197:Fry UTSW 5 150469767 missense
R7256:Fry UTSW 5 150466786 missense
R7318:Fry UTSW 5 150436993 missense probably damaging 0.98
R7323:Fry UTSW 5 150496349 missense
Predicted Primers PCR Primer
(F):5'- AGGCACTTGTAGGCACTTTCACG -3'
(R):5'- CTGACTGTCCTGGAACCTGTTTGG -3'

Sequencing Primer
(F):5'- ggcaagcaagccctttattac -3'
(R):5'- GTTGACTAGGCTACAGGCTAACTG -3'
Posted On2013-06-12