Incidental Mutation 'R0538:Cacna2d2'
ID49602
Institutional Source Beutler Lab
Gene Symbol Cacna2d2
Ensembl Gene ENSMUSG00000010066
Gene Namecalcium channel, voltage-dependent, alpha 2/delta subunit 2
Synonymsa2d2
MMRRC Submission 038730-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.829) question?
Stock #R0538 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location107399612-107529343 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 107524383 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010210] [ENSMUST00000085092] [ENSMUST00000164988] [ENSMUST00000166799] [ENSMUST00000168532] [ENSMUST00000170737]
Predicted Effect probably benign
Transcript: ENSMUST00000010210
SMART Domains Protein: ENSMUSP00000010210
Gene: ENSMUSG00000010066

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 9.9e-32 PFAM
Pfam:VGCC_alpha2 583 673 1.8e-33 PFAM
low complexity region 968 977 N/A INTRINSIC
low complexity region 1114 1137 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085092
SMART Domains Protein: ENSMUSP00000082173
Gene: ENSMUSG00000010066

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 1e-31 PFAM
Pfam:VGCC_alpha2 583 676 5.8e-35 PFAM
low complexity region 974 983 N/A INTRINSIC
low complexity region 1120 1143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164988
SMART Domains Protein: ENSMUSP00000130451
Gene: ENSMUSG00000010066

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 6.7e-49 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 2.4e-31 PFAM
Pfam:VGCC_alpha2 583 675 2.5e-34 PFAM
low complexity region 974 983 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166799
SMART Domains Protein: ENSMUSP00000126029
Gene: ENSMUSG00000010066

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 8.5e-44 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 576 1.3e-32 PFAM
Pfam:VGCC_alpha2 583 675 1.4e-47 PFAM
low complexity region 975 984 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168532
SMART Domains Protein: ENSMUSP00000132512
Gene: ENSMUSG00000010066

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2.1e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 1e-31 PFAM
Pfam:VGCC_alpha2 583 676 5.8e-35 PFAM
low complexity region 974 983 N/A INTRINSIC
low complexity region 1122 1145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168959
Predicted Effect probably benign
Transcript: ENSMUST00000170737
SMART Domains Protein: ENSMUSP00000125943
Gene: ENSMUSG00000010066

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 1e-31 PFAM
Pfam:VGCC_alpha2 583 673 1.9e-33 PFAM
low complexity region 968 977 N/A INTRINSIC
low complexity region 1116 1139 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194842
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency 98% (126/129)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcium channels mediate the entry of calcium ions into the cell upon membrane polarization. This gene encodes the alpha-2/delta subunit of the voltage-dependent calcium channel complex. The complex consists of the main channel-forming subunit alpha-1, and auxiliary subunits alpha-2/delta, beta, and gamma. The auxiliary subunits function in the assembly and membrane localization of the complex, and modulate calcium currents and channel activation/inactivation kinetics. The subunit encoded by this gene undergoes post-translational cleavage to yield the extracellular alpha2 peptide and a membrane-anchored delta polypeptide. This subunit is a receptor for the antiepileptic drug, gabapentin. Mutations in this gene are associated with early infantile epileptic encephalopathy. Single nucleotide polymorphisms in this gene are correlated with increased sensitivity to opioid drugs. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for different mutant alleles show variable movement abnormalities including waddling, reeling or very slow gait, ataxia, and mild spike-wave seizures. While gross CNS abnormalities and demyelination are present in some mutant lines, they are not observed in others. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik A T 14: 66,938,374 H6L unknown Het
Abca13 G A 11: 9,267,622 probably null Het
Acad12 C T 5: 121,607,448 R260Q possibly damaging Het
Actn1 G A 12: 80,260,100 probably benign Het
Acvrl1 A G 15: 101,136,149 T182A probably damaging Het
Adam23 T C 1: 63,567,844 probably benign Het
Adamtsl1 A T 4: 86,343,121 T1190S probably benign Het
Adh6b A T 3: 138,357,650 Y330F probably benign Het
Ak7 A G 12: 105,766,617 E540G probably damaging Het
Akr1c19 T A 13: 4,237,100 L106Q probably damaging Het
Ankrd12 A T 17: 66,049,852 S57T probably damaging Het
Aoc3 G A 11: 101,332,138 R400Q possibly damaging Het
Arel1 A T 12: 84,941,837 I46N probably damaging Het
Armc5 A G 7: 128,244,291 D752G probably damaging Het
Atp11b T C 3: 35,837,014 V812A probably damaging Het
Axin1 A G 17: 26,184,241 H131R possibly damaging Het
Bpifb3 A G 2: 153,923,869 E184G probably benign Het
Catsperd T C 17: 56,662,828 F641L probably benign Het
Ccdc83 A C 7: 90,228,383 L284V probably damaging Het
Ccnt2 T A 1: 127,803,165 V593E probably damaging Het
Cd53 T A 3: 106,762,128 I185F probably benign Het
Cep350 A T 1: 155,848,620 D3077E possibly damaging Het
Ces1h C A 8: 93,357,000 probably null Het
Chrna3 T A 9: 55,016,006 T173S probably benign Het
Clca4b T C 3: 144,921,956 D418G probably benign Het
Col11a2 T C 17: 34,051,328 probably benign Het
Coq2 T A 5: 100,668,023 I97F possibly damaging Het
Cr2 A G 1: 195,160,359 probably benign Het
Ctgf T A 10: 24,596,466 C136S probably damaging Het
D2hgdh A G 1: 93,826,377 Y24C probably damaging Het
D630045J12Rik G A 6: 38,191,693 R974C probably damaging Het
Dach1 A G 14: 97,903,279 V429A possibly damaging Het
Ddr1 G A 17: 35,685,007 T660I probably damaging Het
Dlg1 A C 16: 31,796,864 probably null Het
Dmbt1 T C 7: 131,049,901 probably benign Het
Dmxl2 A T 9: 54,393,836 D2330E probably benign Het
Doc2a A G 7: 126,848,811 T5A probably benign Het
Dock2 G A 11: 34,704,718 probably benign Het
Dok4 T A 8: 94,865,238 Y290F probably damaging Het
Dopey1 A G 9: 86,485,497 D11G probably damaging Het
E230025N22Rik T C 18: 36,688,934 H235R probably benign Het
Ear6 A G 14: 51,854,452 D152G probably damaging Het
Ecscr T A 18: 35,713,636 probably benign Het
Eml6 A T 11: 29,760,010 probably benign Het
Epha4 T A 1: 77,388,541 Q607L probably damaging Het
Exoc4 A G 6: 33,972,063 N947S probably benign Het
Flg A G 3: 93,279,460 E73G probably damaging Het
Fndc1 C T 17: 7,784,341 probably benign Het
Gad1-ps T C 10: 99,444,992 noncoding transcript Het
Gata6 A G 18: 11,064,771 T528A probably benign Het
Gjd4 T C 18: 9,280,244 E278G probably benign Het
Gm13101 T A 4: 143,965,083 T357S possibly damaging Het
Gm20091 T A 10: 96,409,002 noncoding transcript Het
Gnb3 G A 6: 124,835,696 Q266* probably null Het
Grm3 A G 5: 9,512,446 V468A possibly damaging Het
Igf1r C T 7: 68,207,826 R1085C probably damaging Het
Igsf10 T C 3: 59,320,106 T2049A probably damaging Het
Jak3 A T 8: 71,685,482 D859V probably benign Het
Kcnb2 G T 1: 15,712,884 probably benign Het
Kcnh3 G A 15: 99,240,958 G858D probably benign Het
Kif1a C A 1: 93,043,638 R1006L probably damaging Het
Klhl23 C T 2: 69,824,413 A209V probably benign Het
Mapk13 T C 17: 28,775,255 Y104H probably damaging Het
Mbd4 A G 6: 115,849,482 S183P probably damaging Het
Mga T C 2: 119,919,706 probably null Het
Mipol1 G A 12: 57,414,411 probably null Het
Mmp14 A G 14: 54,438,709 T299A possibly damaging Het
Mmrn1 A G 6: 60,976,469 E578G probably benign Het
Mov10l1 G A 15: 88,994,860 C193Y possibly damaging Het
Mppe1 A G 18: 67,237,477 C50R probably damaging Het
Msantd1 C A 5: 34,917,725 R44S probably damaging Het
Myt1l T C 12: 29,842,571 V69A possibly damaging Het
Nav1 A T 1: 135,464,692 probably benign Het
Ncan A G 8: 70,108,602 S572P possibly damaging Het
Nck2 T C 1: 43,569,144 probably benign Het
Nemf A T 12: 69,356,314 D31E probably damaging Het
Nlrp12 T C 7: 3,249,262 D93G possibly damaging Het
Nsmaf A T 4: 6,419,930 probably null Het
Nup98 T C 7: 102,186,685 T184A probably damaging Het
Olfr1415 A T 1: 92,491,333 C141S possibly damaging Het
Olfr46 A T 7: 140,610,384 N73Y probably damaging Het
Olfr522 A T 7: 140,162,231 S240T probably damaging Het
Oog2 C A 4: 144,196,084 Y306* probably null Het
Osmr A G 15: 6,841,938 probably benign Het
P2rx6 A G 16: 17,568,298 N275S probably benign Het
Papd4 A T 13: 93,175,615 probably benign Het
Pbxip1 G T 3: 89,447,619 G482W possibly damaging Het
Pcsk4 T G 10: 80,325,334 I249L probably damaging Het
Pou4f2 C T 8: 78,435,662 G104E probably damaging Het
Prkdc G T 16: 15,833,788 R3763L probably damaging Het
Ptpre A T 7: 135,663,315 I207F probably damaging Het
Rapgef3 A T 15: 97,757,817 probably benign Het
Rasgrp1 T G 2: 117,284,947 K685T probably benign Het
Rnf148 C T 6: 23,654,238 R253Q probably damaging Het
Rock1 T C 18: 10,132,227 I241V possibly damaging Het
Rp1l1 T G 14: 64,022,092 V61G probably damaging Het
Scin A C 12: 40,081,771 S255A probably damaging Het
Scn8a A T 15: 101,035,624 K1570* probably null Het
Sec14l4 A C 11: 4,040,018 M106L probably benign Het
Sec63 G A 10: 42,798,799 R226H probably benign Het
Sept2 T A 1: 93,501,623 N271K probably damaging Het
Serac1 G T 17: 6,048,826 probably benign Het
Shc2 T A 10: 79,630,140 probably benign Het
Sipa1l1 T A 12: 82,425,099 D1284E probably benign Het
Slc11a2 A G 15: 100,408,216 L105P probably damaging Het
Slc1a3 T A 15: 8,650,922 T151S probably benign Het
Smarca2 G T 19: 26,691,362 K920N probably damaging Het
Sugp2 G A 8: 70,258,948 E964K probably damaging Het
Tas2r122 A C 6: 132,711,815 N38K probably benign Het
Tecpr1 G A 5: 144,206,274 R730C probably damaging Het
Themis3 G T 17: 66,593,270 N34K possibly damaging Het
Traf3ip1 A G 1: 91,499,619 T104A unknown Het
Trappc11 A G 8: 47,503,412 V843A probably benign Het
Trmt61a T A 12: 111,678,927 L99Q probably damaging Het
Trp53tg5 T A 2: 164,471,481 K91N probably damaging Het
Ufsp2 T C 8: 45,992,150 S339P probably damaging Het
Usp20 T A 2: 31,004,450 V126E probably damaging Het
Vmn1r75 T A 7: 11,880,870 N176K probably damaging Het
Vmn2r24 A G 6: 123,816,053 S780G probably benign Het
Vmn2r89 A G 14: 51,457,591 probably null Het
Vps13d A T 4: 145,045,095 S4038T probably damaging Het
Vwa7 A G 17: 35,022,651 T421A probably damaging Het
Wdr78 T C 4: 103,096,618 N128S possibly damaging Het
Wdr95 C A 5: 149,580,806 L332I probably damaging Het
Wrn T A 8: 33,336,091 K181I probably damaging Het
Zc3h6 T A 2: 129,017,223 I1058N possibly damaging Het
Zfp423 T A 8: 87,782,085 I544F probably damaging Het
Zfp446 T A 7: 12,979,589 S161T possibly damaging Het
Zmym6 T A 4: 127,123,369 M889K probably benign Het
Other mutations in Cacna2d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Cacna2d2 APN 9 107514873 missense probably damaging 1.00
IGL00425:Cacna2d2 APN 9 107527351 missense probably damaging 1.00
IGL01294:Cacna2d2 APN 9 107514081 missense probably damaging 1.00
IGL01969:Cacna2d2 APN 9 107509216 missense probably benign
IGL01974:Cacna2d2 APN 9 107517422 missense probably benign 0.00
IGL02001:Cacna2d2 APN 9 107522116 missense probably benign
IGL02125:Cacna2d2 APN 9 107513904 nonsense probably null
IGL02143:Cacna2d2 APN 9 107518275 splice site probably null
IGL02150:Cacna2d2 APN 9 107527316 splice site probably benign
IGL02213:Cacna2d2 APN 9 107514048 missense probably damaging 1.00
IGL02220:Cacna2d2 APN 9 107514879 missense probably damaging 1.00
IGL02238:Cacna2d2 APN 9 107513558 missense probably damaging 0.99
IGL02466:Cacna2d2 APN 9 107465554 missense probably damaging 1.00
IGL02569:Cacna2d2 APN 9 107514046 missense probably damaging 0.99
IGL02571:Cacna2d2 APN 9 107525646 missense possibly damaging 0.93
IGL02825:Cacna2d2 APN 9 107524460 missense probably damaging 1.00
IGL03000:Cacna2d2 APN 9 107524198 splice site probably null
IGL03064:Cacna2d2 APN 9 107509275 missense probably damaging 1.00
Blow UTSW 9 107513606 missense probably null 0.90
hera UTSW 9 107513280 missense probably damaging 1.00
PIT4131001:Cacna2d2 UTSW 9 107524668 missense probably damaging 1.00
R0233:Cacna2d2 UTSW 9 107514670 missense probably damaging 0.96
R0233:Cacna2d2 UTSW 9 107514670 missense probably damaging 0.96
R0387:Cacna2d2 UTSW 9 107513881 missense probably damaging 1.00
R0410:Cacna2d2 UTSW 9 107524620 missense probably damaging 1.00
R0545:Cacna2d2 UTSW 9 107525223 missense probably damaging 1.00
R0729:Cacna2d2 UTSW 9 107517257 missense probably benign 0.06
R1024:Cacna2d2 UTSW 9 107527050 critical splice donor site probably null
R1538:Cacna2d2 UTSW 9 107517416 missense probably damaging 1.00
R1750:Cacna2d2 UTSW 9 107524644 missense probably damaging 1.00
R1774:Cacna2d2 UTSW 9 107526151 missense probably benign 0.19
R1800:Cacna2d2 UTSW 9 107527433 missense possibly damaging 0.46
R1873:Cacna2d2 UTSW 9 107513872 missense probably damaging 0.98
R1935:Cacna2d2 UTSW 9 107509256 missense probably damaging 1.00
R1936:Cacna2d2 UTSW 9 107509256 missense probably damaging 1.00
R1971:Cacna2d2 UTSW 9 107512006 missense probably damaging 0.98
R2095:Cacna2d2 UTSW 9 107527165 missense probably benign 0.05
R2135:Cacna2d2 UTSW 9 107526513 missense possibly damaging 0.74
R2197:Cacna2d2 UTSW 9 107527403 missense probably damaging 0.97
R2266:Cacna2d2 UTSW 9 107513280 missense probably damaging 1.00
R2483:Cacna2d2 UTSW 9 107512022 missense probably damaging 1.00
R4021:Cacna2d2 UTSW 9 107514058 missense probably damaging 1.00
R4392:Cacna2d2 UTSW 9 107400280 missense possibly damaging 0.47
R4629:Cacna2d2 UTSW 9 107527322 missense probably damaging 1.00
R5053:Cacna2d2 UTSW 9 107514864 missense probably damaging 1.00
R5327:Cacna2d2 UTSW 9 107513606 missense probably null 0.90
R5347:Cacna2d2 UTSW 9 107514114 missense probably benign
R5719:Cacna2d2 UTSW 9 107524652 missense probably benign 0.36
R5737:Cacna2d2 UTSW 9 107526747 missense possibly damaging 0.70
R5739:Cacna2d2 UTSW 9 107512329 missense probably benign 0.37
R6037:Cacna2d2 UTSW 9 107513539 missense probably damaging 1.00
R6037:Cacna2d2 UTSW 9 107513539 missense probably damaging 1.00
R6084:Cacna2d2 UTSW 9 107497521 critical splice donor site probably null
R6170:Cacna2d2 UTSW 9 107527334 missense probably damaging 1.00
R6254:Cacna2d2 UTSW 9 107509216 missense probably benign
R6427:Cacna2d2 UTSW 9 107515442 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TCCAAGCAGTGTGAGTATAGGGCG -3'
(R):5'- ACCATCAGTGGCAGCAAATACGGC -3'

Sequencing Primer
(F):5'- TGAGTATAGGGCGGGACCTC -3'
(R):5'- ATGGGGTCACAGGCTCAC -3'
Posted On2013-06-12