Incidental Mutation 'R6240:Prag1'
ID505175
Institutional Source Beutler Lab
Gene Symbol Prag1
Ensembl Gene ENSMUSG00000050271
Gene NamePEAK1 related kinase activating pseudokinase 1
SynonymsD8Ertd82e, NACK
MMRRC Submission 044364-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.283) question?
Stock #R6240 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location36094828-36147787 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36103352 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 363 (L363P)
Ref Sequence ENSEMBL: ENSMUSP00000106118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110492]
Predicted Effect probably benign
Transcript: ENSMUST00000110492
AA Change: L363P

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000106118
Gene: ENSMUSG00000050271
AA Change: L363P

DomainStartEndE-ValueType
low complexity region 317 333 N/A INTRINSIC
low complexity region 395 412 N/A INTRINSIC
low complexity region 525 544 N/A INTRINSIC
low complexity region 781 793 N/A INTRINSIC
low complexity region 892 925 N/A INTRINSIC
Pfam:Pkinase_Tyr 1060 1288 1.7e-7 PFAM
Pfam:Pkinase 1061 1293 1.5e-13 PFAM
low complexity region 1363 1373 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150295
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that belongs to the tyrosine protein kinase family. A similar protein in rat binds to Rho family GTPase 2 (Rnd2) and regulates neurite outgrowth via activation of Ras homolog gene family, member A (RhoA). [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C A 14: 63,986,252 R25L probably damaging Het
9930021J03Rik A T 19: 29,717,240 S1618T probably benign Het
Adamts1 G A 16: 85,802,157 S185L probably benign Het
Adamts12 A T 15: 11,285,958 D751V probably benign Het
Adgrg3 A G 8: 95,039,916 D405G probably benign Het
Ahi1 A G 10: 20,977,081 D516G probably damaging Het
Ahnak A T 19: 9,013,583 D4077V probably damaging Het
Arhgef18 G A 8: 3,439,658 R330Q probably damaging Het
Arid1a A G 4: 133,680,686 V2170A unknown Het
Asxl3 C T 18: 22,465,508 L227F probably damaging Het
B3glct A G 5: 149,726,788 I119V probably benign Het
Cad T A 5: 31,072,978 M1512K probably benign Het
Cdc25a A G 9: 109,884,158 T172A probably damaging Het
Cdh18 A G 15: 23,226,936 D161G possibly damaging Het
Clmp A G 9: 40,782,411 N308S probably damaging Het
Dlg5 A T 14: 24,149,528 probably null Het
Dscam G A 16: 96,619,502 T1728M probably damaging Het
E4f1 A G 17: 24,444,582 S524P possibly damaging Het
Epha5 G C 5: 84,117,579 A452G probably benign Het
Fzd3 T C 14: 65,209,855 T542A probably damaging Het
Glyctk A T 9: 106,156,262 probably null Het
Gm10382 G A 5: 125,389,596 probably benign Het
Gm8765 G A 13: 50,701,417 D364N probably damaging Het
Hnmt T A 2: 24,014,269 M127L probably benign Het
Hoxc10 T A 15: 102,970,830 W262R probably damaging Het
Icam5 T A 9: 21,033,158 W52R possibly damaging Het
Jazf1 A T 6: 52,777,552 C180S probably damaging Het
Kcnk2 A G 1: 189,242,982 W286R probably damaging Het
Kcnmb2 C T 3: 32,181,896 S98F probably damaging Het
Mob3a C G 10: 80,689,864 E204D possibly damaging Het
Morc3 C G 16: 93,862,684 H459D probably damaging Het
Mroh2b A T 15: 4,934,644 N876I probably benign Het
Myo16 A T 8: 10,370,930 T257S probably damaging Het
Nat1 A T 8: 67,491,702 R243S possibly damaging Het
Nudt9 T C 5: 104,047,089 V17A probably benign Het
Olfr1205 A G 2: 88,831,363 D82G probably benign Het
Olfr1216 A G 2: 89,013,626 I146T probably benign Het
Olfr1340 A G 4: 118,726,471 S75G probably benign Het
Olfr734 A G 14: 50,320,586 V83A probably benign Het
Olfr814 C A 10: 129,874,677 V27L probably benign Het
Pcdh7 T C 5: 57,721,362 L753P probably damaging Het
Pcf11 T A 7: 92,646,502 E1446D probably damaging Het
Pepd A G 7: 35,021,751 I267V probably benign Het
Plk2 T A 13: 110,399,474 Y571N probably damaging Het
Plk2 T A 13: 110,400,034 V620E probably damaging Het
Psmd3 A G 11: 98,693,653 T387A probably damaging Het
Ptgs1 G A 2: 36,237,285 C61Y probably damaging Het
Rab18 T C 18: 6,784,635 Y109H probably benign Het
Robo2 G A 16: 73,982,139 P358L probably damaging Het
Smarcc2 C T 10: 128,488,024 probably benign Het
Srgap1 A G 10: 122,047,156 I13T probably benign Het
Tcf12 T A 9: 71,944,016 K110* probably null Het
Tdrd1 T C 19: 56,841,335 S214P probably benign Het
Tdrd3 T A 14: 87,505,886 N417K probably damaging Het
Tmem255b A G 8: 13,454,216 Y136C probably damaging Het
Tmem63c A T 12: 87,076,405 I448F possibly damaging Het
Tnpo1 T C 13: 98,863,829 I335M probably damaging Het
Vmn1r1 T C 1: 182,157,621 T160A probably damaging Het
Vmn1r203 A G 13: 22,524,729 N227D possibly damaging Het
Vmn2r6 T A 3: 64,556,805 S203C probably damaging Het
Zfp628 A G 7: 4,919,849 T357A possibly damaging Het
Zfp872 A G 9: 22,199,884 K220E probably damaging Het
Other mutations in Prag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Prag1 APN 8 36099931 missense probably benign 0.01
IGL01132:Prag1 APN 8 36146357 missense probably damaging 1.00
IGL01322:Prag1 APN 8 36103934 missense probably benign 0.01
IGL01343:Prag1 APN 8 36103046 missense possibly damaging 0.95
IGL01726:Prag1 APN 8 36102992 missense probably damaging 1.00
IGL01739:Prag1 APN 8 36102680 missense probably benign 0.00
IGL02420:Prag1 APN 8 36147426 utr 3 prime probably benign
IGL02433:Prag1 APN 8 36139568 missense probably damaging 1.00
IGL02627:Prag1 APN 8 36139439 missense possibly damaging 0.93
IGL02797:Prag1 APN 8 36139501 missense probably damaging 1.00
IGL03070:Prag1 APN 8 36103549 missense probably benign 0.01
IGL03323:Prag1 APN 8 36140008 missense probably damaging 1.00
FR4340:Prag1 UTSW 8 36103886 small insertion probably benign
FR4548:Prag1 UTSW 8 36103885 small insertion probably benign
FR4589:Prag1 UTSW 8 36103883 small insertion probably benign
FR4976:Prag1 UTSW 8 36103883 small insertion probably benign
R0325:Prag1 UTSW 8 36103804 missense probably benign 0.00
R0486:Prag1 UTSW 8 36146633 missense probably damaging 1.00
R0506:Prag1 UTSW 8 36103700 missense possibly damaging 0.92
R0507:Prag1 UTSW 8 36104123 missense probably damaging 1.00
R0595:Prag1 UTSW 8 36147002 missense probably damaging 1.00
R0618:Prag1 UTSW 8 36099833 missense probably damaging 1.00
R0618:Prag1 UTSW 8 36099833 missense probably damaging 1.00
R0885:Prag1 UTSW 8 36103267 missense probably benign 0.00
R1015:Prag1 UTSW 8 36146543 missense probably damaging 1.00
R1168:Prag1 UTSW 8 36146645 missense probably damaging 1.00
R1182:Prag1 UTSW 8 36147259 missense possibly damaging 0.95
R1227:Prag1 UTSW 8 36139951 missense probably damaging 1.00
R1282:Prag1 UTSW 8 36099914 missense probably damaging 0.96
R1469:Prag1 UTSW 8 36146298 splice site probably benign
R1656:Prag1 UTSW 8 36104346 missense probably damaging 1.00
R1660:Prag1 UTSW 8 36140023 missense possibly damaging 0.73
R1676:Prag1 UTSW 8 36102898 missense probably damaging 0.96
R1820:Prag1 UTSW 8 36103804 missense probably benign 0.00
R1970:Prag1 UTSW 8 36129160 splice site probably null
R1974:Prag1 UTSW 8 36102927 missense probably damaging 1.00
R4398:Prag1 UTSW 8 36103655 missense probably damaging 1.00
R4429:Prag1 UTSW 8 36146642 missense probably damaging 1.00
R4627:Prag1 UTSW 8 36103292 missense probably damaging 1.00
R4980:Prag1 UTSW 8 36139586 missense probably damaging 1.00
R5131:Prag1 UTSW 8 36139969 missense probably damaging 1.00
R5215:Prag1 UTSW 8 36099889 missense probably benign 0.06
R5346:Prag1 UTSW 8 36103685 missense probably damaging 1.00
R5414:Prag1 UTSW 8 36139622 missense probably benign 0.00
R5535:Prag1 UTSW 8 36104014 missense probably benign
R5687:Prag1 UTSW 8 36146813 missense probably benign 0.02
R5785:Prag1 UTSW 8 36103487 missense probably benign 0.35
R5817:Prag1 UTSW 8 36103703 missense probably damaging 1.00
R6002:Prag1 UTSW 8 36104183 missense probably benign 0.31
R6127:Prag1 UTSW 8 36147401 missense unknown
R6277:Prag1 UTSW 8 36146591 missense probably damaging 1.00
R6326:Prag1 UTSW 8 36102706 missense possibly damaging 0.79
R6741:Prag1 UTSW 8 36147280 missense probably benign 0.41
R6925:Prag1 UTSW 8 36103894 missense probably damaging 1.00
R7085:Prag1 UTSW 8 36104237 missense possibly damaging 0.71
R7095:Prag1 UTSW 8 36102560 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAACAGGGTCTGAGCTTCCC -3'
(R):5'- ATACTTGGCCCTGGCTATGG -3'

Sequencing Primer
(F):5'- TCTGAGCTTCCCCAGAGAGTG -3'
(R):5'- GCCAGCTGGGACCTGCTC -3'
Posted On2018-02-28