Incidental Mutation 'R6286:Cntnap5b'
ID508214
Institutional Source Beutler Lab
Gene Symbol Cntnap5b
Ensembl Gene ENSMUSG00000067028
Gene Namecontactin associated protein-like 5B
SynonymsCaspr5-2, C230078M14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R6286 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location99772765-100485942 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100255073 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 276 (S276T)
Ref Sequence ENSEMBL: ENSMUSP00000139877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086738] [ENSMUST00000188735]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086738
AA Change: S590T

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000083944
Gene: ENSMUSG00000067028
AA Change: S590T

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FA58C 39 174 2.76e-16 SMART
LamG 201 338 2.84e-27 SMART
LamG 387 521 9.22e-27 SMART
EGF 549 583 1.14e0 SMART
Blast:FBG 586 758 3e-66 BLAST
LamG 798 925 2.12e-26 SMART
EGF 946 982 1.51e0 SMART
LamG 1023 1159 2.14e-13 SMART
transmembrane domain 1227 1249 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185484
Predicted Effect possibly damaging
Transcript: ENSMUST00000188735
AA Change: S276T

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139877
Gene: ENSMUSG00000067028
AA Change: S276T

DomainStartEndE-ValueType
LamG 73 207 5.9e-29 SMART
EGF 235 269 5.6e-3 SMART
Blast:FBG 272 402 2e-42 BLAST
LamG 415 554 2.5e-11 SMART
EGF 575 611 7.1e-3 SMART
LamG 652 788 1.4e-15 SMART
transmembrane domain 856 878 N/A INTRINSIC
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alk T A 17: 71,880,847 M1300L probably damaging Het
BC080695 T A 4: 143,571,226 V72D probably benign Het
C3 A T 17: 57,224,118 I356N probably damaging Het
Cts7 C T 13: 61,352,770 G321E probably damaging Het
Cyp11a1 G A 9: 58,017,418 probably benign Het
Ddx4 T C 13: 112,613,735 T421A probably damaging Het
Dnttip2 A G 3: 122,284,400 T694A probably damaging Het
Eif3b G T 5: 140,419,811 D151Y probably damaging Het
Fhad1 T A 4: 141,920,898 E219V probably damaging Het
Gdf2 C T 14: 33,945,100 R260C probably damaging Het
Gm14295 T C 2: 176,809,568 Y284H possibly damaging Het
Gm45861 A G 8: 27,529,591 T745A unknown Het
Grin2a G A 16: 9,761,775 T208I possibly damaging Het
Ide T A 19: 37,278,010 Y798F unknown Het
Llgl1 G A 11: 60,709,532 G569D probably damaging Het
Mrpl9 G C 3: 94,443,790 E92D probably benign Het
Muc16 T A 9: 18,644,389 H3536L unknown Het
Nasp T C 4: 116,604,788 Y526C probably damaging Het
Nfx1 A G 4: 40,986,728 N404D probably damaging Het
Nsrp1 A G 11: 77,049,443 I112T probably damaging Het
Olfr145 A T 9: 37,897,778 I125F probably damaging Het
Olfr789 T C 10: 129,487,628 L206P probably damaging Het
Oxsr1 A G 9: 119,264,882 V235A probably damaging Het
Pamr1 C T 2: 102,640,948 Q539* probably null Het
Ptpn4 A G 1: 119,721,862 probably null Het
Ranbp2 C T 10: 58,479,572 A2038V probably benign Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Homo
Sept5 A G 16: 18,623,377 V253A probably damaging Het
Slc22a13 C A 9: 119,208,712 E117* probably null Het
Slc9c1 T C 16: 45,577,831 I653T probably benign Het
Slco6c1 T A 1: 97,125,720 H152L possibly damaging Het
Sp2 A C 11: 96,961,546 V184G probably benign Het
Taok1 T A 11: 77,553,773 H492L probably benign Het
Tas2r110 G A 6: 132,868,527 D174N probably benign Het
Trim24 G A 6: 37,919,491 probably null Het
Ttc37 T C 13: 76,143,240 L993P probably damaging Het
Ttn G A 2: 76,750,977 R21445* probably null Het
Ttn A G 2: 76,775,623 Y16502H probably damaging Het
Vmn2r84 A C 10: 130,390,868 M367R possibly damaging Het
Zfp46 T C 4: 136,291,009 S385P probably damaging Het
Other mutations in Cntnap5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Cntnap5b APN 1 100050754 missense probably damaging 1.00
IGL00477:Cntnap5b APN 1 100213743 missense probably damaging 0.97
IGL00505:Cntnap5b APN 1 100379161 missense possibly damaging 0.81
IGL00596:Cntnap5b APN 1 100379161 missense possibly damaging 0.81
IGL00846:Cntnap5b APN 1 100164223 missense probably damaging 1.00
IGL00895:Cntnap5b APN 1 100383585 missense probably damaging 0.98
IGL00948:Cntnap5b APN 1 100141357 missense probably benign 0.00
IGL01073:Cntnap5b APN 1 100076030 missense probably benign 0.08
IGL01523:Cntnap5b APN 1 100431779 missense probably benign 0.02
IGL01779:Cntnap5b APN 1 99967339 missense probably damaging 1.00
IGL02253:Cntnap5b APN 1 100164211 missense possibly damaging 0.75
IGL02628:Cntnap5b APN 1 100072069 missense probably damaging 0.97
R0166:Cntnap5b UTSW 1 100274361 missense probably benign 0.41
R0211:Cntnap5b UTSW 1 100478374 missense possibly damaging 0.82
R0281:Cntnap5b UTSW 1 100072153 missense probably benign 0.22
R0363:Cntnap5b UTSW 1 100274468 missense probably benign 0.01
R0514:Cntnap5b UTSW 1 99772786 missense probably benign
R0645:Cntnap5b UTSW 1 100072042 splice site probably benign
R0848:Cntnap5b UTSW 1 100255163 missense probably benign 0.22
R1006:Cntnap5b UTSW 1 100383617 missense probably benign 0.00
R1349:Cntnap5b UTSW 1 100164088 missense probably benign 0.09
R1372:Cntnap5b UTSW 1 100164088 missense probably benign 0.09
R1474:Cntnap5b UTSW 1 100072089 missense probably benign 0.25
R1681:Cntnap5b UTSW 1 100076107 missense probably damaging 0.98
R1727:Cntnap5b UTSW 1 100213744 missense possibly damaging 0.91
R1760:Cntnap5b UTSW 1 99772810 missense probably benign 0.05
R1777:Cntnap5b UTSW 1 100370078 missense probably benign 0.10
R1939:Cntnap5b UTSW 1 99967348 missense probably benign
R1988:Cntnap5b UTSW 1 100072140 missense possibly damaging 0.92
R2069:Cntnap5b UTSW 1 100358725 missense probably benign 0.04
R2113:Cntnap5b UTSW 1 100274415 missense probably benign
R2148:Cntnap5b UTSW 1 100383474 missense probably benign 0.01
R2158:Cntnap5b UTSW 1 100390572 missense probably damaging 1.00
R2223:Cntnap5b UTSW 1 100213687 missense probably damaging 1.00
R2350:Cntnap5b UTSW 1 100379126 missense probably damaging 1.00
R3840:Cntnap5b UTSW 1 100383477 missense possibly damaging 0.50
R4329:Cntnap5b UTSW 1 100072163 missense probably damaging 0.99
R4609:Cntnap5b UTSW 1 99772847 critical splice donor site probably null
R4799:Cntnap5b UTSW 1 100358725 missense probably benign 0.04
R5129:Cntnap5b UTSW 1 100379090 missense probably damaging 1.00
R5323:Cntnap5b UTSW 1 100383550 nonsense probably null
R5434:Cntnap5b UTSW 1 100072201 missense probably benign 0.02
R5579:Cntnap5b UTSW 1 100383395 nonsense probably null
R5579:Cntnap5b UTSW 1 100383399 missense probably benign 0.27
R5630:Cntnap5b UTSW 1 100072069 missense probably damaging 0.99
R5644:Cntnap5b UTSW 1 100383601 missense probably benign 0.00
R5761:Cntnap5b UTSW 1 100446894 missense probably damaging 1.00
R6042:Cntnap5b UTSW 1 100390592 missense probably benign
R6147:Cntnap5b UTSW 1 100050781 missense probably damaging 1.00
R6190:Cntnap5b UTSW 1 100379075 missense possibly damaging 0.80
R6248:Cntnap5b UTSW 1 100072102 missense probably benign 0.30
R6306:Cntnap5b UTSW 1 100164146 missense probably damaging 1.00
R6336:Cntnap5b UTSW 1 100358669 missense probably benign 0.00
R6360:Cntnap5b UTSW 1 100431736 nonsense probably null
R6722:Cntnap5b UTSW 1 100478486 missense probably damaging 0.98
R6750:Cntnap5b UTSW 1 100274499 missense probably damaging 1.00
R6806:Cntnap5b UTSW 1 99940649 missense probably damaging 1.00
R6933:Cntnap5b UTSW 1 100383450 missense probably benign 0.01
R6957:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6958:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6959:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6961:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6962:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R7088:Cntnap5b UTSW 1 100160077 missense probably damaging 0.99
R7146:Cntnap5b UTSW 1 100050794 splice site probably null
R7165:Cntnap5b UTSW 1 100076162 missense possibly damaging 0.94
R7190:Cntnap5b UTSW 1 100431849 splice site probably null
R7376:Cntnap5b UTSW 1 99967269 missense possibly damaging 0.92
R7385:Cntnap5b UTSW 1 100379090 missense probably damaging 1.00
X0020:Cntnap5b UTSW 1 100431848 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTTTGAGTGGAAAATTCAAGCAG -3'
(R):5'- CCCCATGAATCTAGTCCTGTAGG -3'

Sequencing Primer
(F):5'- TCTAGGGGCCTCAAGTTCCAAC -3'
(R):5'- AGTCCTGTAGGTATTTTTACACTCTG -3'
Posted On2018-03-15