Incidental Mutation 'R6320:Cyp20a1'
ID510068
Institutional Source Beutler Lab
Gene Symbol Cyp20a1
Ensembl Gene ENSMUSG00000049439
Gene Namecytochrome P450, family 20, subfamily a, polypeptide 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6320 (G1)
Quality Score212.009
Status Validated
Chromosome1
Chromosomal Location60343323-60388060 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 60352172 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000050823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060608] [ENSMUST00000148443]
Predicted Effect probably null
Transcript: ENSMUST00000060608
SMART Domains Protein: ENSMUSP00000050823
Gene: ENSMUSG00000049439

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:p450 40 456 1.5e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114202
SMART Domains Protein: ENSMUSP00000109840
Gene: ENSMUSG00000049439

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
Pfam:p450 40 280 1.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191764
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases that catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein lacks one amino acid of the conserved heme binding site. It also lacks the conserved I-helix motif AGX(D,E)T, suggesting that its substrate may carry its own oxygen. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,753,849 V189A probably benign Het
Agtr1b G T 3: 20,315,779 A221D probably benign Het
Aldh18a1 A T 19: 40,570,561 D280E probably benign Het
Apob G A 12: 7,989,194 D475N probably benign Het
Bmi1 C T 2: 18,684,375 T290I probably benign Het
Brd8 A T 18: 34,613,239 D139E possibly damaging Het
Cacna1e C A 1: 154,441,524 V1467F possibly damaging Het
Cdh15 A G 8: 122,864,347 D445G probably benign Het
Ceacam5 T A 7: 17,747,198 L290H probably damaging Het
Celsr1 G T 15: 85,900,959 Q3025K probably benign Het
Chil1 T A 1: 134,182,258 M1K probably null Het
Crybg2 T C 4: 134,081,426 S1404P probably damaging Het
Cubn C A 2: 13,280,195 C3470F probably damaging Het
Cyp24a1 G T 2: 170,486,784 T408K probably benign Het
Cyp2a12 A T 7: 27,031,152 I181F possibly damaging Het
Dnm1l A T 16: 16,332,088 I268N probably damaging Het
Eif2a A G 3: 58,557,096 probably null Het
Epg5 T C 18: 77,962,398 F701S probably damaging Het
Fbxo46 T C 7: 19,136,541 S362P possibly damaging Het
Fgf22 A G 10: 79,756,996 probably benign Het
Fhod1 A C 8: 105,337,350 probably benign Het
Flnc T A 6: 29,459,063 V2448D probably damaging Het
Gm2696 G T 10: 77,836,138 probably benign Het
Gmpr T C 13: 45,532,398 S214P possibly damaging Het
Krt6a A G 15: 101,692,309 V308A probably damaging Het
Lig3 T A 11: 82,794,007 probably null Het
Lrrc37a T A 11: 103,504,051 N183Y probably benign Het
Mapk8ip3 C A 17: 24,906,905 G422V probably damaging Het
Mks1 T C 11: 87,855,499 S97P probably benign Het
Mphosph9 A T 5: 124,324,961 V7E probably damaging Het
Msh5 A G 17: 35,029,924 L711P probably damaging Het
Naga T A 15: 82,332,203 probably null Het
Nlrp10 T A 7: 108,925,746 T176S possibly damaging Het
Nqo1 T C 8: 107,388,950 N232D probably benign Het
Olfr11 T A 13: 21,639,248 I92L probably damaging Het
Olfr50 C G 2: 36,793,573 N112K possibly damaging Het
P2ry6 A G 7: 100,938,396 F252S probably damaging Het
P3h3 G A 6: 124,854,872 R317W probably benign Het
Palm2 T A 4: 57,710,173 C373S probably damaging Het
Pdzd3 A G 9: 44,248,683 V380A probably benign Het
Phkb T A 8: 85,875,698 D39E probably benign Het
Psg16 G A 7: 17,088,187 G23D probably damaging Het
Ptgr2 T A 12: 84,302,337 I150K probably benign Het
Ptprf A G 4: 118,212,814 V1457A probably benign Het
Sart3 A T 5: 113,751,240 Y508N probably benign Het
Sh3bp1 C T 15: 78,911,515 P615S probably damaging Het
Ska3 A T 14: 57,816,691 N267K probably benign Het
Slc26a7 A G 4: 14,524,498 I462T probably benign Het
Slu7 C T 11: 43,441,489 A244V probably benign Het
Smarca4 C T 9: 21,637,375 P319L probably damaging Het
Smg9 A G 7: 24,420,861 D420G probably benign Het
Strc T A 2: 121,374,958 D25V probably benign Het
Syne2 T G 12: 76,061,650 V936G probably damaging Het
Tbc1d7 C T 13: 43,152,933 probably benign Het
Terb1 C A 8: 104,447,199 D751Y probably damaging Het
Trpc1 A G 9: 95,721,250 Y410H probably damaging Het
Ush2a A G 1: 188,356,846 N333D probably benign Het
Usp34 T C 11: 23,452,520 S2438P probably damaging Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zfp7 G A 15: 76,890,610 G284D possibly damaging Het
Zfyve26 A G 12: 79,240,002 S2271P probably damaging Het
Zscan18 G A 7: 12,775,220 probably benign Het
Other mutations in Cyp20a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02146:Cyp20a1 APN 1 60371251 missense possibly damaging 0.79
IGL02725:Cyp20a1 APN 1 60366706 missense probably benign 0.08
IGL03394:Cyp20a1 APN 1 60366681 missense probably damaging 0.99
R0003:Cyp20a1 UTSW 1 60387126 splice site probably benign
R0098:Cyp20a1 UTSW 1 60387254 nonsense probably null
R0098:Cyp20a1 UTSW 1 60387254 nonsense probably null
R0217:Cyp20a1 UTSW 1 60343466 splice site probably benign
R0491:Cyp20a1 UTSW 1 60371327 missense possibly damaging 0.71
R1543:Cyp20a1 UTSW 1 60376194 splice site probably benign
R4519:Cyp20a1 UTSW 1 60387147 missense probably damaging 1.00
R4621:Cyp20a1 UTSW 1 60376099 missense probably benign
R4930:Cyp20a1 UTSW 1 60366719 missense probably damaging 0.98
R4980:Cyp20a1 UTSW 1 60363214 missense probably damaging 1.00
R5088:Cyp20a1 UTSW 1 60363350 missense probably damaging 0.99
R5356:Cyp20a1 UTSW 1 60379387 missense probably benign 0.08
R5545:Cyp20a1 UTSW 1 60376082 missense possibly damaging 0.71
R5897:Cyp20a1 UTSW 1 60353061 missense probably damaging 1.00
R5926:Cyp20a1 UTSW 1 60363242 missense possibly damaging 0.52
R6317:Cyp20a1 UTSW 1 60352124 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACACAGGATATACGTGATATGG -3'
(R):5'- AACATACATTAGGGCCAAGGC -3'

Sequencing Primer
(F):5'- AGGATATACGTGATATGGTTAACTGG -3'
(R):5'- CATACATTAGGGCCAAGGCTGTAC -3'
Posted On2018-04-02