Incidental Mutation 'R6320:Palm2'
ID510079
Institutional Source Beutler Lab
Gene Symbol Palm2
Ensembl Gene ENSMUSG00000090053
Gene Nameparalemmin 2
Synonyms53-H12, pEN70
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R6320 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location57434247-57712016 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57710173 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 373 (C373S)
Ref Sequence ENSEMBL: ENSMUSP00000099969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098066] [ENSMUST00000102904] [ENSMUST00000102905] [ENSMUST00000126465] [ENSMUST00000142556]
Predicted Effect probably benign
Transcript: ENSMUST00000098066
SMART Domains Protein: ENSMUSP00000095674
Gene: ENSMUSG00000089945

DomainStartEndE-ValueType
Pfam:Paralemmin 67 138 6.3e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102904
AA Change: C373S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099968
Gene: ENSMUSG00000090053
AA Change: C373S

DomainStartEndE-ValueType
Pfam:Paralemmin 66 376 8e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102905
AA Change: C373S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099969
Gene: ENSMUSG00000090053
AA Change: C373S

DomainStartEndE-ValueType
Pfam:Paralemmin 67 376 5.8e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126465
SMART Domains Protein: ENSMUSP00000130230
Gene: ENSMUSG00000089945

DomainStartEndE-ValueType
Pfam:Paralemmin 67 138 6.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131201
Predicted Effect probably benign
Transcript: ENSMUST00000142556
SMART Domains Protein: ENSMUSP00000129817
Gene: ENSMUSG00000090053

DomainStartEndE-ValueType
Pfam:Paralemmin 66 136 8.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150412
SMART Domains Protein: ENSMUSP00000117466
Gene: ENSMUSG00000089945

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
low complexity region 35 59 N/A INTRINSIC
Pfam:Paralemmin 115 269 6.5e-23 PFAM
low complexity region 396 407 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
coiled coil region 499 557 N/A INTRINSIC
Pfam:AKAP2_C 847 1129 1.9e-17 PFAM
Meta Mutation Damage Score 0.268 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,753,849 V189A probably benign Het
Agtr1b G T 3: 20,315,779 A221D probably benign Het
Aldh18a1 A T 19: 40,570,561 D280E probably benign Het
Apob G A 12: 7,989,194 D475N probably benign Het
Bmi1 C T 2: 18,684,375 T290I probably benign Het
Brd8 A T 18: 34,613,239 D139E possibly damaging Het
Cacna1e C A 1: 154,441,524 V1467F possibly damaging Het
Cdh15 A G 8: 122,864,347 D445G probably benign Het
Ceacam5 T A 7: 17,747,198 L290H probably damaging Het
Celsr1 G T 15: 85,900,959 Q3025K probably benign Het
Chil1 T A 1: 134,182,258 M1K probably null Het
Crybg2 T C 4: 134,081,426 S1404P probably damaging Het
Cubn C A 2: 13,280,195 C3470F probably damaging Het
Cyp20a1 T C 1: 60,352,172 probably null Het
Cyp24a1 G T 2: 170,486,784 T408K probably benign Het
Cyp2a12 A T 7: 27,031,152 I181F possibly damaging Het
Dnm1l A T 16: 16,332,088 I268N probably damaging Het
Eif2a A G 3: 58,557,096 probably null Het
Epg5 T C 18: 77,962,398 F701S probably damaging Het
Fbxo46 T C 7: 19,136,541 S362P possibly damaging Het
Fgf22 A G 10: 79,756,996 probably benign Het
Fhod1 A C 8: 105,337,350 probably benign Het
Flnc T A 6: 29,459,063 V2448D probably damaging Het
Gm2696 G T 10: 77,836,138 probably benign Het
Gmpr T C 13: 45,532,398 S214P possibly damaging Het
Krt6a A G 15: 101,692,309 V308A probably damaging Het
Lig3 T A 11: 82,794,007 probably null Het
Lrrc37a T A 11: 103,504,051 N183Y probably benign Het
Mapk8ip3 C A 17: 24,906,905 G422V probably damaging Het
Mks1 T C 11: 87,855,499 S97P probably benign Het
Mphosph9 A T 5: 124,324,961 V7E probably damaging Het
Msh5 A G 17: 35,029,924 L711P probably damaging Het
Naga T A 15: 82,332,203 probably null Het
Nlrp10 T A 7: 108,925,746 T176S possibly damaging Het
Nqo1 T C 8: 107,388,950 N232D probably benign Het
Olfr11 T A 13: 21,639,248 I92L probably damaging Het
Olfr50 C G 2: 36,793,573 N112K possibly damaging Het
P2ry6 A G 7: 100,938,396 F252S probably damaging Het
P3h3 G A 6: 124,854,872 R317W probably benign Het
Pdzd3 A G 9: 44,248,683 V380A probably benign Het
Phkb T A 8: 85,875,698 D39E probably benign Het
Psg16 G A 7: 17,088,187 G23D probably damaging Het
Ptgr2 T A 12: 84,302,337 I150K probably benign Het
Ptprf A G 4: 118,212,814 V1457A probably benign Het
Sart3 A T 5: 113,751,240 Y508N probably benign Het
Sh3bp1 C T 15: 78,911,515 P615S probably damaging Het
Ska3 A T 14: 57,816,691 N267K probably benign Het
Slc26a7 A G 4: 14,524,498 I462T probably benign Het
Slu7 C T 11: 43,441,489 A244V probably benign Het
Smarca4 C T 9: 21,637,375 P319L probably damaging Het
Smg9 A G 7: 24,420,861 D420G probably benign Het
Strc T A 2: 121,374,958 D25V probably benign Het
Syne2 T G 12: 76,061,650 V936G probably damaging Het
Tbc1d7 C T 13: 43,152,933 probably benign Het
Terb1 C A 8: 104,447,199 D751Y probably damaging Het
Trpc1 A G 9: 95,721,250 Y410H probably damaging Het
Ush2a A G 1: 188,356,846 N333D probably benign Het
Usp34 T C 11: 23,452,520 S2438P probably damaging Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zfp7 G A 15: 76,890,610 G284D possibly damaging Het
Zfyve26 A G 12: 79,240,002 S2271P probably damaging Het
Zscan18 G A 7: 12,775,220 probably benign Het
Other mutations in Palm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02736:Palm2 APN 4 57709721 missense probably damaging 0.96
PIT4305001:Palm2 UTSW 4 57638029 missense possibly damaging 0.94
R0158:Palm2 UTSW 4 57709649 missense possibly damaging 0.96
R0244:Palm2 UTSW 4 57710177 missense possibly damaging 0.74
R0763:Palm2 UTSW 4 57688441 missense probably damaging 1.00
R0800:Palm2 UTSW 4 57709650 missense probably benign 0.06
R1861:Palm2 UTSW 4 57709468 missense probably damaging 0.97
R1895:Palm2 UTSW 4 57638068 missense probably benign 0.01
R4600:Palm2 UTSW 4 57709954 missense probably benign 0.26
R6365:Palm2 UTSW 4 57709675 nonsense probably null
R6983:Palm2 UTSW 4 57709973 missense probably damaging 1.00
R7090:Palm2 UTSW 4 57648042 missense probably benign 0.00
X0065:Palm2 UTSW 4 57709805 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGCGGAATTAGTCCTGATTG -3'
(R):5'- TGTTTCCCAAGTGAGGAGAAGG -3'

Sequencing Primer
(F):5'- CGGAATTAGTCCTGATTGATGAAGAC -3'
(R):5'- TTCCCAAGTGAGGAGAAGGAAAGATG -3'
Posted On2018-04-02