Incidental Mutation 'R6338:Arhgap11a'
ID514304
Institutional Source Beutler Lab
Gene Symbol Arhgap11a
Ensembl Gene ENSMUSG00000041219
Gene NameRho GTPase activating protein 11A
SynonymsGAP (1-12), 6530401L14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6338 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location113831492-113848661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113833725 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 738 (S738G)
Ref Sequence ENSEMBL: ENSMUSP00000106574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024005] [ENSMUST00000102545] [ENSMUST00000110947] [ENSMUST00000110948] [ENSMUST00000110949]
Predicted Effect probably benign
Transcript: ENSMUST00000024005
SMART Domains Protein: ENSMUSP00000024005
Gene: ENSMUSG00000023236

DomainStartEndE-ValueType
Pfam:Secretogranin_V 23 160 4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102545
AA Change: S738G

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099604
Gene: ENSMUSG00000041219
AA Change: S738G

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
RhoGAP 63 236 1.97e-47 SMART
Blast:RhoGAP 288 349 3e-20 BLAST
low complexity region 490 501 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110947
SMART Domains Protein: ENSMUSP00000106572
Gene: ENSMUSG00000041219

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
RhoGAP 63 236 1.97e-47 SMART
Blast:RhoGAP 288 349 7e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000110948
SMART Domains Protein: ENSMUSP00000106573
Gene: ENSMUSG00000041219

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
RhoGAP 63 236 1.97e-47 SMART
Blast:RhoGAP 288 349 6e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000110949
AA Change: S738G

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106574
Gene: ENSMUSG00000041219
AA Change: S738G

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
RhoGAP 63 236 1.97e-47 SMART
Blast:RhoGAP 288 349 3e-20 BLAST
low complexity region 490 501 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139975
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho GTPase activating protein family. In response to DNA damage, the encoded protein interacts with the p53 tumor suppressor protein and stimulates its tetramerization, which results in cell-cycle arrest and apoptosis. A chromosomal deletion that includes this gene is one cause of Prader-Willi syndrome, and an intronic variant of this gene may be associated with sleep duration in children. This gene is highly expressed in colon cancers and in a human basal-like breast cancer cell line. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 T C 7: 98,257,715 Y128C probably damaging Het
Adam30 T G 3: 98,161,541 I102S probably damaging Het
Adcy8 A T 15: 64,920,617 D163E possibly damaging Het
Agrn C T 4: 156,170,585 E1614K probably benign Het
Aldh16a1 A T 7: 45,141,961 W107R probably damaging Het
Arfgef2 A G 2: 166,845,570 D238G probably damaging Het
Arid5b C A 10: 68,098,561 G504* probably null Het
Carmil3 T C 14: 55,499,849 V763A possibly damaging Het
Cd209e T A 8: 3,849,154 D186V probably damaging Het
Cdh23 T C 10: 60,413,151 D882G probably damaging Het
Cdh4 T C 2: 179,890,812 V689A probably damaging Het
Cntn6 T A 6: 104,726,139 V174E probably damaging Het
Col7a1 C T 9: 108,956,633 T390M unknown Het
Crybg1 T C 10: 43,992,509 D1017G probably damaging Het
Csmd1 T G 8: 15,932,492 K2725T possibly damaging Het
Dnaaf2 T C 12: 69,198,122 E55G probably damaging Het
Fam13a A G 6: 58,953,499 V476A probably damaging Het
Fem1b A T 9: 62,797,011 D322E probably benign Het
Frmpd1 G A 4: 45,274,489 V466I probably benign Het
Gm11639 C T 11: 104,843,208 R2027* probably null Het
Gm20671 A T 5: 32,820,647 D1794E probably damaging Het
Gpatch2 G T 1: 187,225,514 R22L probably damaging Het
Gtf2h1 A G 7: 46,816,456 T450A probably benign Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Krit1 T G 5: 3,836,857 M702R probably benign Het
Krt34 T C 11: 100,038,490 N298S probably benign Het
Lrrcc1 T A 3: 14,547,316 N376K possibly damaging Het
Myo15 A G 11: 60,478,133 E573G probably damaging Het
Olfr1224-ps1 T A 2: 89,156,371 K268I probably damaging Het
Olfr1390 A G 11: 49,340,867 S112G probably benign Het
Olfr366 A T 2: 37,219,822 D111V probably damaging Het
Olfr391-ps A T 11: 73,799,319 L146Q possibly damaging Het
Olfr661 T A 7: 104,688,171 V52E possibly damaging Het
Olfr736 T A 14: 50,393,400 F215I possibly damaging Het
Phf20 A T 2: 156,273,686 Q309L possibly damaging Het
Plcd1 G A 9: 119,074,991 R292C probably damaging Het
Pold3 A G 7: 100,088,105 V342A possibly damaging Het
Polr2a A T 11: 69,739,679 probably null Het
Ptprcap A G 19: 4,156,224 E102G probably benign Het
Rab11fip5 T C 6: 85,341,378 E843G possibly damaging Het
Rai14 T C 15: 10,574,976 D632G probably damaging Het
Rnf149 A T 1: 39,560,742 C268S probably null Het
Slc6a13 T A 6: 121,334,839 F392I probably damaging Het
Slc7a11 C T 3: 50,384,043 probably null Het
Slf1 T A 13: 77,084,462 probably null Het
Stard9 G A 2: 120,697,485 V1408I probably benign Het
Suclg1 T C 6: 73,264,246 I183T probably damaging Het
Syne1 T C 10: 5,255,475 E3497G probably benign Het
Tax1bp1 C T 6: 52,729,376 R121* probably null Het
Tdpoz2 C T 3: 93,652,336 V110I probably benign Het
Ubn2 A G 6: 38,490,714 T788A probably benign Het
Unc13c T A 9: 73,734,447 I1255F probably damaging Het
Usp44 G T 10: 93,846,513 R275I probably damaging Het
Uspl1 A G 5: 149,215,034 N1015D probably benign Het
Wbp2nl G T 15: 82,299,045 W13C possibly damaging Het
Zc3h14 T A 12: 98,758,590 D170E possibly damaging Het
Other mutations in Arhgap11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Arhgap11a APN 2 113834256 missense probably benign 0.00
IGL00337:Arhgap11a APN 2 113841942 missense probably damaging 0.96
IGL00532:Arhgap11a APN 2 113834066 missense probably benign
IGL00869:Arhgap11a APN 2 113834826 missense probably damaging 0.99
IGL01123:Arhgap11a APN 2 113834773 splice site probably benign
IGL01353:Arhgap11a APN 2 113833524 missense probably damaging 1.00
IGL01725:Arhgap11a APN 2 113837552 missense probably damaging 0.98
IGL01911:Arhgap11a APN 2 113840732 missense probably damaging 1.00
IGL02077:Arhgap11a APN 2 113837471 missense possibly damaging 0.94
IGL02532:Arhgap11a APN 2 113833676 nonsense probably null
IGL02553:Arhgap11a APN 2 113837561 splice site probably benign
IGL02738:Arhgap11a APN 2 113832975 makesense probably null
IGL02945:Arhgap11a APN 2 113837473 missense possibly damaging 0.83
R0480:Arhgap11a UTSW 2 113839818 missense probably benign 0.03
R0515:Arhgap11a UTSW 2 113837471 missense possibly damaging 0.48
R0625:Arhgap11a UTSW 2 113841711 missense probably benign 0.01
R0898:Arhgap11a UTSW 2 113836876 missense probably benign 0.01
R1248:Arhgap11a UTSW 2 113834102 missense possibly damaging 0.63
R1395:Arhgap11a UTSW 2 113833122 missense probably benign 0.00
R1669:Arhgap11a UTSW 2 113841912 missense possibly damaging 0.92
R2915:Arhgap11a UTSW 2 113833508 missense probably damaging 1.00
R3941:Arhgap11a UTSW 2 113836897 missense probably damaging 1.00
R4194:Arhgap11a UTSW 2 113841994 missense probably benign 0.02
R4508:Arhgap11a UTSW 2 113842042 missense probably damaging 1.00
R4617:Arhgap11a UTSW 2 113834078 missense probably benign 0.01
R4839:Arhgap11a UTSW 2 113842029 missense probably damaging 1.00
R4842:Arhgap11a UTSW 2 113839762 missense probably damaging 0.98
R5507:Arhgap11a UTSW 2 113841678 missense probably benign
R5538:Arhgap11a UTSW 2 113837530 missense probably benign
R5660:Arhgap11a UTSW 2 113841910 missense possibly damaging 0.80
R5712:Arhgap11a UTSW 2 113845301 missense probably benign 0.09
R5849:Arhgap11a UTSW 2 113834847 missense probably null 0.01
R5856:Arhgap11a UTSW 2 113833771 missense possibly damaging 0.63
R6101:Arhgap11a UTSW 2 113834874 nonsense probably null
R6119:Arhgap11a UTSW 2 113834350 missense probably benign
R6563:Arhgap11a UTSW 2 113833902 missense probably benign 0.00
R6919:Arhgap11a UTSW 2 113839709 missense possibly damaging 0.94
X0065:Arhgap11a UTSW 2 113834231 missense probably benign 0.41
Z1088:Arhgap11a UTSW 2 113842894 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTTCTGACGGACTGACGGAC -3'
(R):5'- GAAGGCCTGCACTCAGAAAC -3'

Sequencing Primer
(F):5'- CGCTGAAATTTAAGAGGTGACTTCAC -3'
(R):5'- GCACTCAGAAACACCCAAAGCTG -3'
Posted On2018-04-27