Incidental Mutation 'R6338:Ubn2'
ID514318
Institutional Source Beutler Lab
Gene Symbol Ubn2
Ensembl Gene ENSMUSG00000038538
Gene Nameubinuclein 2
SynonymsD130059P03Rik, 6030408G03Rik, 2900060J04Rik
MMRRC Submission
Accession Numbers

Genbank: NM_177185; MGI: 2444236

Is this an essential gene? Probably essential (E-score: 0.829) question?
Stock #R6338 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location38433950-38524825 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38490714 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 788 (T788A)
Ref Sequence ENSEMBL: ENSMUSP00000036188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039127] [ENSMUST00000160583] [ENSMUST00000162593]
Predicted Effect probably benign
Transcript: ENSMUST00000039127
AA Change: T788A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000036188
Gene: ENSMUSG00000038538
AA Change: T788A

DomainStartEndE-ValueType
low complexity region 34 57 N/A INTRINSIC
low complexity region 74 109 N/A INTRINSIC
Pfam:HUN 180 231 4.8e-22 PFAM
low complexity region 256 285 N/A INTRINSIC
low complexity region 294 309 N/A INTRINSIC
low complexity region 328 345 N/A INTRINSIC
low complexity region 389 399 N/A INTRINSIC
Pfam:UBN_AB 434 650 6.4e-80 PFAM
low complexity region 687 717 N/A INTRINSIC
low complexity region 822 833 N/A INTRINSIC
low complexity region 846 881 N/A INTRINSIC
low complexity region 1002 1042 N/A INTRINSIC
low complexity region 1156 1168 N/A INTRINSIC
low complexity region 1180 1199 N/A INTRINSIC
low complexity region 1247 1263 N/A INTRINSIC
low complexity region 1280 1297 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159215
Predicted Effect probably benign
Transcript: ENSMUST00000159447
SMART Domains Protein: ENSMUSP00000123836
Gene: ENSMUSG00000038538

DomainStartEndE-ValueType
low complexity region 119 159 N/A INTRINSIC
low complexity region 273 285 N/A INTRINSIC
low complexity region 297 309 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159925
Predicted Effect probably benign
Transcript: ENSMUST00000160583
AA Change: T786A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124043
Gene: ENSMUSG00000038538
AA Change: T786A

DomainStartEndE-ValueType
low complexity region 34 57 N/A INTRINSIC
low complexity region 74 109 N/A INTRINSIC
Pfam:HUN 178 232 3.8e-23 PFAM
low complexity region 256 285 N/A INTRINSIC
low complexity region 294 309 N/A INTRINSIC
low complexity region 328 345 N/A INTRINSIC
low complexity region 389 399 N/A INTRINSIC
Pfam:UBN_AB 434 650 2.9e-86 PFAM
low complexity region 685 715 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
low complexity region 844 879 N/A INTRINSIC
low complexity region 1000 1040 N/A INTRINSIC
low complexity region 1154 1166 N/A INTRINSIC
low complexity region 1178 1197 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
low complexity region 1278 1295 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162423
Predicted Effect probably benign
Transcript: ENSMUST00000162593
AA Change: T635A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124352
Gene: ENSMUSG00000038538
AA Change: T635A

DomainStartEndE-ValueType
Pfam:HUN 10 64 4.4e-24 PFAM
low complexity region 88 117 N/A INTRINSIC
low complexity region 126 141 N/A INTRINSIC
low complexity region 160 177 N/A INTRINSIC
low complexity region 221 231 N/A INTRINSIC
Pfam:UBN_AB 266 482 3.1e-87 PFAM
low complexity region 534 564 N/A INTRINSIC
low complexity region 669 680 N/A INTRINSIC
low complexity region 693 728 N/A INTRINSIC
low complexity region 849 889 N/A INTRINSIC
low complexity region 1003 1015 N/A INTRINSIC
low complexity region 1027 1039 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI

All alleles(14) : Gene trapped(14)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 T C 7: 98,257,715 Y128C probably damaging Het
Adam30 T G 3: 98,161,541 I102S probably damaging Het
Adcy8 A T 15: 64,920,617 D163E possibly damaging Het
Agrn C T 4: 156,170,585 E1614K probably benign Het
Aldh16a1 A T 7: 45,141,961 W107R probably damaging Het
Arfgef2 A G 2: 166,845,570 D238G probably damaging Het
Arhgap11a T C 2: 113,833,725 S738G probably benign Het
Arid5b C A 10: 68,098,561 G504* probably null Het
Carmil3 T C 14: 55,499,849 V763A possibly damaging Het
Cd209e T A 8: 3,849,154 D186V probably damaging Het
Cdh23 T C 10: 60,413,151 D882G probably damaging Het
Cdh4 T C 2: 179,890,812 V689A probably damaging Het
Cntn6 T A 6: 104,726,139 V174E probably damaging Het
Col7a1 C T 9: 108,956,633 T390M unknown Het
Crybg1 T C 10: 43,992,509 D1017G probably damaging Het
Csmd1 T G 8: 15,932,492 K2725T possibly damaging Het
Dnaaf2 T C 12: 69,198,122 E55G probably damaging Het
Fam13a A G 6: 58,953,499 V476A probably damaging Het
Fem1b A T 9: 62,797,011 D322E probably benign Het
Frmpd1 G A 4: 45,274,489 V466I probably benign Het
Gm11639 C T 11: 104,843,208 R2027* probably null Het
Gm20671 A T 5: 32,820,647 D1794E probably damaging Het
Gpatch2 G T 1: 187,225,514 R22L probably damaging Het
Gtf2h1 A G 7: 46,816,456 T450A probably benign Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Krit1 T G 5: 3,836,857 M702R probably benign Het
Krt34 T C 11: 100,038,490 N298S probably benign Het
Lrrcc1 T A 3: 14,547,316 N376K possibly damaging Het
Myo15 A G 11: 60,478,133 E573G probably damaging Het
Olfr1224-ps1 T A 2: 89,156,371 K268I probably damaging Het
Olfr1390 A G 11: 49,340,867 S112G probably benign Het
Olfr366 A T 2: 37,219,822 D111V probably damaging Het
Olfr391-ps A T 11: 73,799,319 L146Q possibly damaging Het
Olfr661 T A 7: 104,688,171 V52E possibly damaging Het
Olfr736 T A 14: 50,393,400 F215I possibly damaging Het
Phf20 A T 2: 156,273,686 Q309L possibly damaging Het
Plcd1 G A 9: 119,074,991 R292C probably damaging Het
Pold3 A G 7: 100,088,105 V342A possibly damaging Het
Polr2a A T 11: 69,739,679 probably null Het
Ptprcap A G 19: 4,156,224 E102G probably benign Het
Rab11fip5 T C 6: 85,341,378 E843G possibly damaging Het
Rai14 T C 15: 10,574,976 D632G probably damaging Het
Rnf149 A T 1: 39,560,742 C268S probably null Het
Slc6a13 T A 6: 121,334,839 F392I probably damaging Het
Slc7a11 C T 3: 50,384,043 probably null Het
Slf1 T A 13: 77,084,462 probably null Het
Stard9 G A 2: 120,697,485 V1408I probably benign Het
Suclg1 T C 6: 73,264,246 I183T probably damaging Het
Syne1 T C 10: 5,255,475 E3497G probably benign Het
Tax1bp1 C T 6: 52,729,376 R121* probably null Het
Tdpoz2 C T 3: 93,652,336 V110I probably benign Het
Unc13c T A 9: 73,734,447 I1255F probably damaging Het
Usp44 G T 10: 93,846,513 R275I probably damaging Het
Uspl1 A G 5: 149,215,034 N1015D probably benign Het
Wbp2nl G T 15: 82,299,045 W13C possibly damaging Het
Zc3h14 T A 12: 98,758,590 D170E possibly damaging Het
Other mutations in Ubn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Ubn2 APN 6 38482605 missense possibly damaging 0.91
IGL03116:Ubn2 APN 6 38491899 missense probably damaging 1.00
IGL03150:Ubn2 APN 6 38463714 missense probably benign
IGL03382:Ubn2 APN 6 38440447 unclassified probably benign
A4554:Ubn2 UTSW 6 38484110 missense probably damaging 1.00
R0008:Ubn2 UTSW 6 38434600 critical splice donor site probably null
R0034:Ubn2 UTSW 6 38491406 synonymous silent
R0121:Ubn2 UTSW 6 38452858 splice site probably benign
R0267:Ubn2 UTSW 6 38482618 critical splice donor site probably null
R1864:Ubn2 UTSW 6 38440490 missense possibly damaging 0.93
R1865:Ubn2 UTSW 6 38440490 missense possibly damaging 0.93
R1892:Ubn2 UTSW 6 38491291 missense probably damaging 1.00
R2174:Ubn2 UTSW 6 38470141 splice site probably null
R2184:Ubn2 UTSW 6 38484094 missense probably damaging 1.00
R2212:Ubn2 UTSW 6 38498739 missense probably benign 0.03
R2442:Ubn2 UTSW 6 38491005 missense probably benign 0.00
R3413:Ubn2 UTSW 6 38498739 missense probably benign 0.03
R4725:Ubn2 UTSW 6 38522305 utr 3 prime probably benign
R4765:Ubn2 UTSW 6 38479140 missense probably damaging 1.00
R4771:Ubn2 UTSW 6 38487153 splice site probably null
R4812:Ubn2 UTSW 6 38463726 missense probably benign
R4934:Ubn2 UTSW 6 38490498 missense probably benign 0.04
R5580:Ubn2 UTSW 6 38483252 missense probably damaging 0.99
R5598:Ubn2 UTSW 6 38490388 missense probably benign 0.00
R5672:Ubn2 UTSW 6 38461527 missense probably damaging 1.00
R5715:Ubn2 UTSW 6 38461477 nonsense probably null
R5817:Ubn2 UTSW 6 38479153 missense probably damaging 1.00
R5919:Ubn2 UTSW 6 38491488 missense possibly damaging 0.50
R5937:Ubn2 UTSW 6 38463982 missense possibly damaging 0.74
R6033:Ubn2 UTSW 6 38470224 critical splice donor site probably null
R6033:Ubn2 UTSW 6 38470224 critical splice donor site probably null
R6174:Ubn2 UTSW 6 38461536 missense probably damaging 1.00
R6653:Ubn2 UTSW 6 38434462 missense possibly damaging 0.72
R7282:Ubn2 UTSW 6 38452876 nonsense probably null
X0010:Ubn2 UTSW 6 38483120 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GATGACTCCCTCGATGAAGAC -3'
(R):5'- TGGCTTGACCTTTGCAGTCC -3'

Sequencing Primer
(F):5'- GATGACTCCCTCGATGAAGACCTTTC -3'
(R):5'- CTGGAGTAGCCTGGCTGG -3'
Posted On2018-04-27