Incidental Mutation 'R6380:Lfng'
ID515259
Institutional Source Beutler Lab
Gene Symbol Lfng
Ensembl Gene ENSMUSG00000029570
Gene NameLFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Synonymslunatic fringe
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.890) question?
Stock #R6380 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location140607320-140615545 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 140614396 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031555] [ENSMUST00000031555]
Predicted Effect probably null
Transcript: ENSMUST00000031555
SMART Domains Protein: ENSMUSP00000031555
Gene: ENSMUSG00000029570

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 37 60 N/A INTRINSIC
Pfam:Fringe 107 357 9.6e-124 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000031555
SMART Domains Protein: ENSMUSP00000031555
Gene: ENSMUSG00000029570

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 37 60 N/A INTRINSIC
Pfam:Fringe 107 357 9.6e-124 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200626
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.5%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the fringe gene family which also includes radical and manic fringe genes. They all encode evolutionarily conserved glycosyltransferases that act in the Notch signaling pathway to define boundaries during embryonic development. While their genomic structure is distinct from other glycosyltransferases, fringe proteins have a fucose-specific beta-1,3-N-acetylglucosaminyltransferase activity that leads to elongation of O-linked fucose residues on Notch, which alters Notch signaling. This gene product is predicted to be a single-pass type II Golgi membrane protein but it may also be secreted and proteolytically processed like the related proteins in mouse and Drosophila (PMID: 9187150). Mutations in this gene have been associated with autosomal recessive spondylocostal dysostosis 3. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a short tail and abnormal rib, somite, and lung development. Mice homozygous mice exhibit reduced female fertility, abnormal hair cells, and abnormal axial skeleton morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik G A 1: 93,160,891 probably null Het
4930590J08Rik G A 6: 91,923,137 G424D probably damaging Het
4932438A13Rik A G 3: 37,033,307 D4019G probably benign Het
Aco1 T C 4: 40,185,028 V566A probably benign Het
Adat1 G T 8: 111,978,072 T414K probably benign Het
Alox12e A G 11: 70,321,101 V194A probably benign Het
Anpep A G 7: 79,841,896 V119A probably benign Het
Atat1 C A 17: 35,908,957 probably null Het
Atp10a G A 7: 58,819,684 W1094* probably null Het
Bcl11b T C 12: 108,003,101 R15G probably benign Het
Btnl1 A G 17: 34,379,494 E28G probably benign Het
Ccnd1 A G 7: 144,939,569 V42A probably benign Het
Cdyl2 T A 8: 116,583,184 K344N probably damaging Het
Cep68 A G 11: 20,230,498 M711T probably benign Het
Cyp2j7 A G 4: 96,229,974 probably null Het
Cyp3a25 A T 5: 145,998,547 D86E probably damaging Het
Dclk1 G T 3: 55,247,194 R15L probably damaging Het
Dpy19l1 T A 9: 24,482,045 K143* probably null Het
Duox2 A G 2: 122,281,002 V1405A probably benign Het
Filip1 T C 9: 79,819,624 E571G probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Jph1 T C 1: 17,091,847 N197S probably damaging Het
Kcnt2 T C 1: 140,509,584 L535S probably damaging Het
Lepr C A 4: 101,764,954 S361* probably null Het
Lpcat2 G A 8: 92,886,581 A250T probably benign Het
Map3k4 A T 17: 12,272,067 M159K possibly damaging Het
Notch3 A T 17: 32,144,559 C1177S probably damaging Het
Olfml2b C T 1: 170,669,231 P477L probably benign Het
Olfr180 T A 16: 58,916,264 I126L probably damaging Het
Olfr586 A T 7: 103,121,929 F281Y probably benign Het
Olfr820 A T 10: 130,017,913 H184L probably benign Het
Pald1 G T 10: 61,350,935 F146L possibly damaging Het
Pcdhga1 A G 18: 37,662,969 D342G probably damaging Het
Plcb2 T C 2: 118,715,468 S579G probably damaging Het
Prdm16 A T 4: 154,341,367 S654T probably benign Het
Rab3gap2 C A 1: 185,235,984 L178I probably damaging Het
Rbfox1 C T 16: 7,224,350 Q23* probably null Het
Slc14a2 T G 18: 78,146,975 T920P probably benign Het
Slc17a6 G A 7: 51,667,463 V411M probably benign Het
Stard6 G A 18: 70,476,388 V33I probably benign Het
Syce1 A T 7: 140,779,065 H178Q probably damaging Het
Syne2 T A 12: 76,104,980 F1872I probably damaging Het
Tor1aip1 T C 1: 156,018,488 E274G possibly damaging Het
Trpm1 A T 7: 64,268,297 T462S probably benign Het
Ugt3a1 C T 15: 9,306,455 A230V probably benign Het
Vmn1r178 A G 7: 23,893,559 T11A possibly damaging Het
Vmn2r69 A T 7: 85,411,859 N172K probably benign Het
Whrn G T 4: 63,418,592 P136T possibly damaging Het
Zfhx4 A G 3: 5,413,110 N3570S probably damaging Het
Zfp689 A G 7: 127,444,796 S221P probably damaging Het
Other mutations in Lfng
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Lfng APN 5 140612535 missense probably damaging 1.00
zigzag UTSW 5 140612535 missense probably damaging 1.00
PIT4305001:Lfng UTSW 5 140612528 missense probably damaging 1.00
R2070:Lfng UTSW 5 140612595 missense possibly damaging 0.63
R2848:Lfng UTSW 5 140611867 missense probably damaging 1.00
R2849:Lfng UTSW 5 140611867 missense probably damaging 1.00
R4689:Lfng UTSW 5 140614439 missense probably damaging 0.99
R4936:Lfng UTSW 5 140612395 splice site probably null
R5516:Lfng UTSW 5 140613263 missense probably damaging 1.00
R5560:Lfng UTSW 5 140614267 missense possibly damaging 0.89
R6334:Lfng UTSW 5 140612767 missense possibly damaging 0.86
R6627:Lfng UTSW 5 140607768 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACGCAGTGCACATCAAGG -3'
(R):5'- TGAAGAACACGACTGCCCAG -3'

Sequencing Primer
(F):5'- ACATCAAGGGACCATTCTCTGTGG -3'
(R):5'- ATAGCCCTGAAGAGCCTCG -3'
Posted On2018-05-04