Incidental Mutation 'R6380:Cdyl2'
ID515274
Institutional Source Beutler Lab
Gene Symbol Cdyl2
Ensembl Gene ENSMUSG00000031758
Gene Namechromodomain protein, Y chromosome-like 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R6380 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location116574400-116732991 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116583184 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 344 (K344N)
Ref Sequence ENSEMBL: ENSMUSP00000104730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109102]
Predicted Effect probably damaging
Transcript: ENSMUST00000109102
AA Change: K344N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104730
Gene: ENSMUSG00000031758
AA Change: K344N

DomainStartEndE-ValueType
CHROMO 6 60 1.25e-17 SMART
Pfam:ECH_1 252 499 5e-33 PFAM
Pfam:ECH_2 258 501 1.6e-14 PFAM
Meta Mutation Damage Score 0.0248 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.5%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik G A 1: 93,160,891 probably null Het
4930590J08Rik G A 6: 91,923,137 G424D probably damaging Het
4932438A13Rik A G 3: 37,033,307 D4019G probably benign Het
Aco1 T C 4: 40,185,028 V566A probably benign Het
Adat1 G T 8: 111,978,072 T414K probably benign Het
Alox12e A G 11: 70,321,101 V194A probably benign Het
Anpep A G 7: 79,841,896 V119A probably benign Het
Atat1 C A 17: 35,908,957 probably null Het
Atp10a G A 7: 58,819,684 W1094* probably null Het
Bcl11b T C 12: 108,003,101 R15G probably benign Het
Btnl1 A G 17: 34,379,494 E28G probably benign Het
Ccnd1 A G 7: 144,939,569 V42A probably benign Het
Cep68 A G 11: 20,230,498 M711T probably benign Het
Cyp2j7 A G 4: 96,229,974 probably null Het
Cyp3a25 A T 5: 145,998,547 D86E probably damaging Het
Dclk1 G T 3: 55,247,194 R15L probably damaging Het
Dpy19l1 T A 9: 24,482,045 K143* probably null Het
Duox2 A G 2: 122,281,002 V1405A probably benign Het
Filip1 T C 9: 79,819,624 E571G probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Jph1 T C 1: 17,091,847 N197S probably damaging Het
Kcnt2 T C 1: 140,509,584 L535S probably damaging Het
Lepr C A 4: 101,764,954 S361* probably null Het
Lfng T A 5: 140,614,396 probably null Het
Lpcat2 G A 8: 92,886,581 A250T probably benign Het
Map3k4 A T 17: 12,272,067 M159K possibly damaging Het
Notch3 A T 17: 32,144,559 C1177S probably damaging Het
Olfml2b C T 1: 170,669,231 P477L probably benign Het
Olfr180 T A 16: 58,916,264 I126L probably damaging Het
Olfr586 A T 7: 103,121,929 F281Y probably benign Het
Olfr820 A T 10: 130,017,913 H184L probably benign Het
Pald1 G T 10: 61,350,935 F146L possibly damaging Het
Pcdhga1 A G 18: 37,662,969 D342G probably damaging Het
Plcb2 T C 2: 118,715,468 S579G probably damaging Het
Prdm16 A T 4: 154,341,367 S654T probably benign Het
Rab3gap2 C A 1: 185,235,984 L178I probably damaging Het
Rbfox1 C T 16: 7,224,350 Q23* probably null Het
Slc14a2 T G 18: 78,146,975 T920P probably benign Het
Slc17a6 G A 7: 51,667,463 V411M probably benign Het
Stard6 G A 18: 70,476,388 V33I probably benign Het
Syce1 A T 7: 140,779,065 H178Q probably damaging Het
Syne2 T A 12: 76,104,980 F1872I probably damaging Het
Tor1aip1 T C 1: 156,018,488 E274G possibly damaging Het
Trpm1 A T 7: 64,268,297 T462S probably benign Het
Ugt3a1 C T 15: 9,306,455 A230V probably benign Het
Vmn1r178 A G 7: 23,893,559 T11A possibly damaging Het
Vmn2r69 A T 7: 85,411,859 N172K probably benign Het
Whrn G T 4: 63,418,592 P136T possibly damaging Het
Zfhx4 A G 3: 5,413,110 N3570S probably damaging Het
Zfp689 A G 7: 127,444,796 S221P probably damaging Het
Other mutations in Cdyl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Cdyl2 APN 8 116595189 splice site probably benign
IGL01670:Cdyl2 APN 8 116624353 missense probably damaging 1.00
IGL01964:Cdyl2 APN 8 116624029 missense probably benign 0.00
IGL02148:Cdyl2 APN 8 116589244 splice site probably benign
IGL02186:Cdyl2 APN 8 116579286 missense possibly damaging 0.78
R0449:Cdyl2 UTSW 8 116583192 missense probably damaging 1.00
R0630:Cdyl2 UTSW 8 116624035 missense probably benign 0.03
R1430:Cdyl2 UTSW 8 116579317 splice site probably benign
R1883:Cdyl2 UTSW 8 116595163 missense probably damaging 1.00
R2326:Cdyl2 UTSW 8 116623798 missense probably benign
R4194:Cdyl2 UTSW 8 116579164 splice site probably null
R4916:Cdyl2 UTSW 8 116579187 missense probably damaging 1.00
R4977:Cdyl2 UTSW 8 116575269 missense probably damaging 0.99
R5092:Cdyl2 UTSW 8 116623940 missense possibly damaging 0.50
R5320:Cdyl2 UTSW 8 116595055 nonsense probably null
R5727:Cdyl2 UTSW 8 116583168 missense probably damaging 1.00
R5830:Cdyl2 UTSW 8 116595084 missense probably benign 0.23
R6077:Cdyl2 UTSW 8 116589390 missense probably damaging 1.00
R6086:Cdyl2 UTSW 8 116589296 missense probably damaging 1.00
R6145:Cdyl2 UTSW 8 116594978 missense probably damaging 1.00
R7152:Cdyl2 UTSW 8 116624327 missense probably damaging 1.00
R7193:Cdyl2 UTSW 8 116623994 missense probably benign 0.09
R7244:Cdyl2 UTSW 8 116575260 nonsense probably null
R7394:Cdyl2 UTSW 8 116624051 missense not run
R7457:Cdyl2 UTSW 8 116579196 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGACCAAGCAAGAAGTTATGG -3'
(R):5'- AGAATCTGCCAGCTCTGTGC -3'

Sequencing Primer
(F):5'- GCAGGAGGCTTACCAGC -3'
(R):5'- CTCTGTGCTTCTGTGAGTAGGGC -3'
Posted On2018-05-04