Incidental Mutation 'R6481:Arhgap26'
ID517144
Institutional Source Beutler Lab
Gene Symbol Arhgap26
Ensembl Gene ENSMUSG00000036452
Gene NameRho GTPase activating protein 26
Synonyms2610010G17Rik, 1810044B20Rik, 4933432P15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R6481 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location38601534-39376284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39150057 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 349 (M349K)
Ref Sequence ENSEMBL: ENSMUSP00000122371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097593] [ENSMUST00000155576]
Predicted Effect probably damaging
Transcript: ENSMUST00000097593
AA Change: M349K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095200
Gene: ENSMUSG00000036452
AA Change: M349K

DomainStartEndE-ValueType
Pfam:BAR_3 6 249 1.8e-90 PFAM
Pfam:IMD 26 231 2.8e-9 PFAM
PH 266 371 3.23e-8 SMART
RhoGAP 387 565 4.51e-65 SMART
low complexity region 584 600 N/A INTRINSIC
low complexity region 617 652 N/A INTRINSIC
low complexity region 657 701 N/A INTRINSIC
SH3 759 814 5.11e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000155576
AA Change: M349K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122371
Gene: ENSMUSG00000036452
AA Change: M349K

DomainStartEndE-ValueType
Pfam:IMD 27 232 1.2e-8 PFAM
PH 266 371 3.23e-8 SMART
RhoGAP 387 565 4.51e-65 SMART
low complexity region 584 600 N/A INTRINSIC
low complexity region 617 652 N/A INTRINSIC
low complexity region 657 702 N/A INTRINSIC
SH3 704 759 5.11e-14 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interaction of a cell with the extracellular matrix triggers integrin cell surface receptors to begin signaling cascades that regulate the organization of the actin-cytoskeleton. One of the proteins involved in these cascades is focal adhesion kinase. The protein encoded by this gene is a GTPase activating protein that binds to focal adhesion kinase and mediates the activity of the GTP binding proteins RhoA and Cdc42. Defects in this gene are a cause of juvenile myelomonocytic leukemia (JMML). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous for a hypomorphic allele display reduced myofiber size, impaired myoblast fusion and abnormal muscle regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428L18Rik T C 1: 31,222,507 probably benign Het
5430419D17Rik A T 7: 131,256,801 D1066V probably benign Het
6430573F11Rik T C 8: 36,498,483 probably null Het
Abca9 G A 11: 110,165,962 Q11* probably null Het
Abcc9 A T 6: 142,604,895 M1273K probably damaging Het
Abi2 A G 1: 60,438,939 probably null Het
Acsm5 A G 7: 119,534,881 E295G probably benign Het
Anapc5 T C 5: 122,800,544 D389G probably benign Het
Ano3 A T 2: 110,795,027 D159E probably benign Het
Arhgef39 A G 4: 43,498,580 probably null Het
Astn1 T C 1: 158,612,462 S867P probably benign Het
Atad3a A T 4: 155,753,641 probably null Het
Cadm1 A T 9: 47,788,109 D91V probably damaging Het
Cc2d2b T C 19: 40,802,395 I933T possibly damaging Het
Celsr3 C G 9: 108,837,084 N1937K possibly damaging Het
Cic A C 7: 25,288,281 T558P possibly damaging Het
Cntln A G 4: 85,067,510 M933V probably benign Het
Coch T C 12: 51,598,173 F170S probably damaging Het
Col1a2 A G 6: 4,538,680 Y1200C unknown Het
Col26a1 T C 5: 136,744,178 M383V probably benign Het
Col4a4 A T 1: 82,453,778 M1595K unknown Het
Crh T C 3: 19,694,337 E47G probably benign Het
Cyhr1 T C 15: 76,658,708 probably null Het
D930020B18Rik T C 10: 121,661,148 probably null Het
Def6 G A 17: 28,226,163 R482H probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dpagt1 T C 9: 44,331,190 L241P probably damaging Het
E2f7 A G 10: 110,774,681 E389G probably damaging Het
Eif2b1 T C 5: 124,577,111 I53V probably benign Het
Fbxo4 A G 15: 3,965,734 L376P probably damaging Het
Fgfr2 A G 7: 130,185,278 S352P possibly damaging Het
Fkbpl C A 17: 34,645,414 P52Q possibly damaging Het
Fry G A 5: 150,386,014 R641H probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm12728 A G 4: 105,794,349 K52R probably damaging Het
Gm8298 T C 3: 59,861,057 Y3H probably benign Het
Gtf2a1l A G 17: 88,711,625 D379G probably benign Het
Gys1 A T 7: 45,442,969 Y332F possibly damaging Het
Hoxa7 T A 6: 52,216,614 probably benign Het
Ifitm1 G A 7: 140,969,606 V101I probably benign Het
Kalrn T A 16: 34,360,984 T95S probably damaging Het
Leng8 A G 7: 4,145,413 Y728C probably damaging Het
Lonp2 G T 8: 86,634,908 D238Y possibly damaging Het
Ltn1 A C 16: 87,378,980 S1757A probably damaging Het
Man2a2 A T 7: 80,364,071 S411T probably damaging Het
Mrps33 C A 6: 39,805,370 probably null Het
Muc16 C T 9: 18,550,677 probably null Het
Muc5ac A G 7: 141,809,071 probably benign Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Olfr1141 T C 2: 87,753,468 N175S probably damaging Het
Olfr1204 A T 2: 88,852,519 T190S probably damaging Het
Olfr122 T G 17: 37,772,303 F217V probably damaging Het
Olfr1340 A G 4: 118,726,733 Y162C probably damaging Het
Olfr50 T A 2: 36,793,777 D180E possibly damaging Het
Olfr545 A T 7: 102,494,139 V212D probably damaging Het
Pag1 T A 3: 9,699,336 E252D possibly damaging Het
Plcd3 T C 11: 103,077,767 Y366C probably damaging Het
Psg17 A C 7: 18,814,450 S465R probably damaging Het
Ptpn9 G T 9: 57,023,040 V50L probably damaging Het
Rab17 T G 1: 90,958,961 S190R probably benign Het
Samd11 A G 4: 156,249,078 probably null Het
Slc17a5 A G 9: 78,538,271 F434S possibly damaging Het
Slc22a15 A G 3: 101,883,583 I202T possibly damaging Het
Slc8a1 G T 17: 81,388,918 Q896K probably benign Het
Slc9a5 A T 8: 105,358,393 K509* probably null Het
Slf2 A C 19: 44,973,164 M1041L probably benign Het
Smn1 A G 13: 100,128,500 probably null Het
Snx9 T C 17: 5,922,209 probably null Het
Soat2 T A 15: 102,162,055 L431Q probably damaging Het
Spam1 T A 6: 24,796,930 N293K probably benign Het
Tatdn1 T C 15: 58,923,911 T66A possibly damaging Het
Tmprss11g A T 5: 86,492,156 S205T probably benign Het
Tnpo3 G T 6: 29,571,101 N431K possibly damaging Het
Trim39 T C 17: 36,268,662 T31A probably benign Het
Tshz3 A G 7: 36,752,339 probably null Het
Ttll11 G A 2: 35,902,754 T359M probably damaging Het
Ttn T G 2: 76,741,499 D26350A probably damaging Het
Ubr4 G T 4: 139,431,751 V2472F probably damaging Het
Vsx2 C T 12: 84,593,104 P265S probably benign Het
Wdr90 C T 17: 25,845,911 G1708R probably damaging Het
Wnt11 A G 7: 98,853,274 Y351C probably damaging Het
Xpo6 A C 7: 126,112,885 N3K probably damaging Het
Zfp445 A G 9: 122,857,566 S165P probably benign Het
Zfp953 A T 13: 67,347,937 Y13* probably null Het
Other mutations in Arhgap26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Arhgap26 APN 18 39286551 missense probably damaging 1.00
IGL01116:Arhgap26 APN 18 39111803 missense probably damaging 0.97
IGL01409:Arhgap26 APN 18 39110451 splice site probably benign
IGL02316:Arhgap26 APN 18 38642546 exon noncoding transcript
IGL02418:Arhgap26 APN 18 39357567 intron probably benign
IGL02588:Arhgap26 APN 18 38601617 unclassified probably benign
IGL03241:Arhgap26 APN 18 39229917 missense probably damaging 1.00
R0184:Arhgap26 UTSW 18 38617673 missense unknown
R0244:Arhgap26 UTSW 18 39363131 missense probably benign 0.05
R0347:Arhgap26 UTSW 18 38617744 missense unknown
R1533:Arhgap26 UTSW 18 39371077 missense probably benign 0.16
R1606:Arhgap26 UTSW 18 39296872 missense probably damaging 1.00
R2066:Arhgap26 UTSW 18 39306728 missense probably damaging 1.00
R2182:Arhgap26 UTSW 18 39357809 intron probably benign
R2291:Arhgap26 UTSW 18 39357698 intron probably benign
R3611:Arhgap26 UTSW 18 38933919 missense probably benign
R3700:Arhgap26 UTSW 18 39120184 missense probably damaging 0.99
R3887:Arhgap26 UTSW 18 39229966 critical splice donor site probably null
R4621:Arhgap26 UTSW 18 38899841 intron probably benign
R4877:Arhgap26 UTSW 18 39296929 splice site probably null
R4910:Arhgap26 UTSW 18 38993637 splice site probably benign
R4911:Arhgap26 UTSW 18 38993637 splice site probably benign
R4954:Arhgap26 UTSW 18 39243641 missense probably benign 0.00
R4967:Arhgap26 UTSW 18 39246840 missense probably damaging 1.00
R5221:Arhgap26 UTSW 18 39110472 nonsense probably null
R5232:Arhgap26 UTSW 18 38993476 start codon destroyed probably null 0.97
R5297:Arhgap26 UTSW 18 39121888 missense probably damaging 1.00
R5372:Arhgap26 UTSW 18 38642456 exon noncoding transcript
R5570:Arhgap26 UTSW 18 39099618 missense probably damaging 0.99
R5692:Arhgap26 UTSW 18 39121892 missense probably damaging 1.00
R5752:Arhgap26 UTSW 18 39286672 missense probably damaging 1.00
R5930:Arhgap26 UTSW 18 39150092 missense probably damaging 0.96
R6131:Arhgap26 UTSW 18 39286585 nonsense probably null
R6251:Arhgap26 UTSW 18 39357827 missense probably null
R6622:Arhgap26 UTSW 18 38899863 intron probably benign
R6799:Arhgap26 UTSW 18 39099607 missense probably damaging 1.00
R6878:Arhgap26 UTSW 18 39227412 missense probably damaging 1.00
R6989:Arhgap26 UTSW 18 39099629 missense probably damaging 1.00
R7248:Arhgap26 UTSW 18 39306854 critical splice donor site probably null
X0013:Arhgap26 UTSW 18 39371112 missense probably damaging 1.00
X0025:Arhgap26 UTSW 18 39150105 missense probably damaging 1.00
Z1088:Arhgap26 UTSW 18 39357671 splice site probably benign
Predicted Primers PCR Primer
(F):5'- GCACCCTGTTAAGCAAATGGG -3'
(R):5'- GCCTCTGGGACATTGGTTTC -3'

Sequencing Primer
(F):5'- CCCTGTTAAGCAAATGGGTTCCTG -3'
(R):5'- CCTCTGGGACATTGGTTTCAAAGAC -3'
Posted On2018-05-21