Incidental Mutation 'R6463:Ucp3'
ID517687
Institutional Source Beutler Lab
Gene Symbol Ucp3
Ensembl Gene ENSMUSG00000032942
Gene Nameuncoupling protein 3 (mitochondrial, proton carrier)
SynonymsUCP-3, Slc25a9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6463 (G1)
Quality Score202.009
Status Validated
Chromosome7
Chromosomal Location100472990-100486432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100480269 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 104 (T104S)
Ref Sequence ENSEMBL: ENSMUSP00000102674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032958] [ENSMUST00000107059]
Predicted Effect probably benign
Transcript: ENSMUST00000032958
AA Change: T104S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000032958
Gene: ENSMUSG00000032942
AA Change: T104S

DomainStartEndE-ValueType
Pfam:Mito_carr 10 107 3.1e-20 PFAM
Pfam:Mito_carr 109 207 9.6e-26 PFAM
Pfam:Mito_carr 210 301 2.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107059
AA Change: T104S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102674
Gene: ENSMUSG00000032942
AA Change: T104S

DomainStartEndE-ValueType
Pfam:Mito_carr 9 107 5.9e-22 PFAM
Pfam:Mito_carr 109 207 1.7e-27 PFAM
Pfam:Mito_carr 209 301 9.4e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133850
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. The different UCPs have tissue-specific expression; this gene is primarily expressed in skeletal muscle. This gene's protein product is postulated to protect mitochondria against lipid-induced oxidative stress. Expression levels of this gene increase when fatty acid supplies to mitochondria exceed their oxidation capacity and the protein enables the export of fatty acids from mitochondria. UCPs contain the three solcar protein domains typically found in MACPs. Two splice variants have been found for this gene.[provided by RefSeq, Nov 2008]
PHENOTYPE: Homozygous null mutants exhibit a lack of superoxide-induced uncoupling in skeletal muscle mitochondria, accompanied by increased reactive oxygen species formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,450,938 H48L probably damaging Het
Aifm3 A G 16: 17,500,789 I185V probably benign Het
Asb7 A T 7: 66,660,236 D77E probably damaging Het
Cacna1i T C 15: 80,355,758 I336T probably damaging Het
Cadps2 A T 6: 23,323,334 L1016* probably null Het
Ccdc129 A G 6: 55,968,678 R795G probably benign Het
Cep63 C A 9: 102,596,155 M504I probably benign Het
Chpf2 G T 5: 24,589,526 L231F probably damaging Het
Cnot10 T C 9: 114,625,902 Y221C probably damaging Het
Col3a1 G A 1: 45,342,205 probably benign Het
Csl T C 10: 99,759,098 D35G probably damaging Het
Csmd3 T C 15: 47,676,479 Y2286C probably damaging Het
Dbt A G 3: 116,539,760 E293G possibly damaging Het
Ddx31 T A 2: 28,847,513 probably null Het
Dnm1 T C 2: 32,309,591 probably benign Het
Elfn1 A G 5: 139,972,285 Y348C probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epha5 T A 5: 84,106,710 I657F probably damaging Het
Fbp1 A G 13: 62,865,010 F123S possibly damaging Het
Hkdc1 T C 10: 62,393,702 N732S probably damaging Het
Itfg1 A G 8: 85,736,151 S448P probably benign Het
Izumo2 A G 7: 44,709,074 K84R probably benign Het
Kbtbd3 A G 9: 4,316,921 Y24C probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Mdn1 T C 4: 32,773,308 L5489P probably damaging Het
Mettl2 G A 11: 105,132,581 probably null Het
Mtr T C 13: 12,216,866 T651A probably benign Het
Naglu A G 11: 101,077,351 probably null Het
Nkx6-1 G T 5: 101,659,476 H347N probably damaging Het
Ntpcr A G 8: 125,736,104 E20G probably benign Het
Oas2 T C 5: 120,734,981 R670G probably null Het
Olfr1208 T C 2: 88,897,118 I160V probably benign Het
Olfr239 G A 17: 33,199,638 V197I probably benign Het
Olfr698 C G 7: 106,752,801 E196Q probably benign Het
Phldb2 A C 16: 45,774,993 V902G probably benign Het
Rdh7 T C 10: 127,885,781 R209G probably benign Het
Slc13a3 A C 2: 165,445,653 L127R probably damaging Het
Slc6a20b T A 9: 123,604,949 I275F possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tmx4 T C 2: 134,620,639 Y124C probably damaging Het
Trh A T 6: 92,242,843 M164K possibly damaging Het
Trhr A G 15: 44,197,585 N167S probably benign Het
Ttll7 G A 3: 146,931,582 R490Q possibly damaging Het
Uck1 T C 2: 32,258,655 N100S probably benign Het
Vmn2r28 T A 7: 5,486,436 H468L probably benign Het
Xaf1 G A 11: 72,308,638 R67H probably benign Het
Ypel4 T C 2: 84,736,743 probably benign Het
Zfp687 A G 3: 95,010,784 I559T probably damaging Het
Other mutations in Ucp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02016:Ucp3 APN 7 100480559 missense probably damaging 1.00
IGL02883:Ucp3 APN 7 100480642 missense probably benign 0.00
IGL03137:Ucp3 APN 7 100482762 splice site probably benign
PIT4576001:Ucp3 UTSW 7 100480251 missense probably benign 0.04
R0023:Ucp3 UTSW 7 100485043 missense probably benign 0.00
R0023:Ucp3 UTSW 7 100485043 missense probably benign 0.00
R0532:Ucp3 UTSW 7 100481979 splice site probably benign
R0616:Ucp3 UTSW 7 100480161 missense probably benign 0.00
R0833:Ucp3 UTSW 7 100479541 nonsense probably null
R1739:Ucp3 UTSW 7 100482720 missense probably benign 0.01
R1939:Ucp3 UTSW 7 100480664 missense probably benign 0.00
R3861:Ucp3 UTSW 7 100480251 missense probably benign 0.04
R3958:Ucp3 UTSW 7 100482739 missense probably benign 0.00
R3959:Ucp3 UTSW 7 100482739 missense probably benign 0.00
R4059:Ucp3 UTSW 7 100482664 missense probably damaging 0.99
R5535:Ucp3 UTSW 7 100480666 missense probably benign 0.45
R6596:Ucp3 UTSW 7 100481933 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCATGCAGTTCCTACAGGCG -3'
(R):5'- AATCTCACCAGTGTCTGTCATC -3'

Sequencing Primer
(F):5'- TTGTTCCCCAGATCCAAGGG -3'
(R):5'- ACCAGTGTCTGTCATCAGCTTG -3'
Posted On2018-05-21