Incidental Mutation 'R6463:Hkdc1'
ID517695
Institutional Source Beutler Lab
Gene Symbol Hkdc1
Ensembl Gene ENSMUSG00000020080
Gene Namehexokinase domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.324) question?
Stock #R6463 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location62383137-62422491 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62393702 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 732 (N732S)
Ref Sequence ENSEMBL: ENSMUSP00000020277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020277]
Predicted Effect probably damaging
Transcript: ENSMUST00000020277
AA Change: N732S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020277
Gene: ENSMUSG00000020080
AA Change: N732S

DomainStartEndE-ValueType
Pfam:Hexokinase_1 21 220 3.3e-71 PFAM
Pfam:Hexokinase_2 225 459 5.6e-79 PFAM
Pfam:Hexokinase_1 469 665 9.5e-76 PFAM
Pfam:Hexokinase_2 670 904 5.1e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159493
Meta Mutation Damage Score 0.294 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hexokinase protein family. The encoded protein is involved in glucose metabolism, and reduced expression may be associated with gestational diabetes mellitus. High expression of this gene may also be associated with poor prognosis in hepatocarcinoma. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality prior to genotyping. Mice heterozygous for a knock-out allele exhibit impaired glucose tolerance and female-specific increased in hepatic triglyceride levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,450,938 H48L probably damaging Het
Aifm3 A G 16: 17,500,789 I185V probably benign Het
Asb7 A T 7: 66,660,236 D77E probably damaging Het
Cacna1i T C 15: 80,355,758 I336T probably damaging Het
Cadps2 A T 6: 23,323,334 L1016* probably null Het
Ccdc129 A G 6: 55,968,678 R795G probably benign Het
Cep63 C A 9: 102,596,155 M504I probably benign Het
Chpf2 G T 5: 24,589,526 L231F probably damaging Het
Cnot10 T C 9: 114,625,902 Y221C probably damaging Het
Col3a1 G A 1: 45,342,205 probably benign Het
Csl T C 10: 99,759,098 D35G probably damaging Het
Csmd3 T C 15: 47,676,479 Y2286C probably damaging Het
Dbt A G 3: 116,539,760 E293G possibly damaging Het
Ddx31 T A 2: 28,847,513 probably null Het
Dnm1 T C 2: 32,309,591 probably benign Het
Elfn1 A G 5: 139,972,285 Y348C probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epha5 T A 5: 84,106,710 I657F probably damaging Het
Fbp1 A G 13: 62,865,010 F123S possibly damaging Het
Itfg1 A G 8: 85,736,151 S448P probably benign Het
Izumo2 A G 7: 44,709,074 K84R probably benign Het
Kbtbd3 A G 9: 4,316,921 Y24C probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Mdn1 T C 4: 32,773,308 L5489P probably damaging Het
Mettl2 G A 11: 105,132,581 probably null Het
Mtr T C 13: 12,216,866 T651A probably benign Het
Naglu A G 11: 101,077,351 probably null Het
Nkx6-1 G T 5: 101,659,476 H347N probably damaging Het
Ntpcr A G 8: 125,736,104 E20G probably benign Het
Oas2 T C 5: 120,734,981 R670G probably null Het
Olfr1208 T C 2: 88,897,118 I160V probably benign Het
Olfr239 G A 17: 33,199,638 V197I probably benign Het
Olfr698 C G 7: 106,752,801 E196Q probably benign Het
Phldb2 A C 16: 45,774,993 V902G probably benign Het
Rdh7 T C 10: 127,885,781 R209G probably benign Het
Slc13a3 A C 2: 165,445,653 L127R probably damaging Het
Slc6a20b T A 9: 123,604,949 I275F possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tmx4 T C 2: 134,620,639 Y124C probably damaging Het
Trh A T 6: 92,242,843 M164K possibly damaging Het
Trhr A G 15: 44,197,585 N167S probably benign Het
Ttll7 G A 3: 146,931,582 R490Q possibly damaging Het
Uck1 T C 2: 32,258,655 N100S probably benign Het
Ucp3 A T 7: 100,480,269 T104S probably benign Het
Vmn2r28 T A 7: 5,486,436 H468L probably benign Het
Xaf1 G A 11: 72,308,638 R67H probably benign Het
Ypel4 T C 2: 84,736,743 probably benign Het
Zfp687 A G 3: 95,010,784 I559T probably damaging Het
Other mutations in Hkdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Hkdc1 APN 10 62393789 missense probably damaging 0.99
IGL01300:Hkdc1 APN 10 62395261 splice site probably benign
IGL01415:Hkdc1 APN 10 62393859 missense probably damaging 1.00
IGL01935:Hkdc1 APN 10 62400386 missense probably damaging 0.97
IGL02903:Hkdc1 APN 10 62400191 critical splice donor site probably null
IGL03100:Hkdc1 APN 10 62417829 missense probably benign 0.00
IGL03154:Hkdc1 APN 10 62385705 missense probably damaging 1.00
R0368:Hkdc1 UTSW 10 62411707 missense probably null 0.04
R0549:Hkdc1 UTSW 10 62400240 missense probably benign
R0667:Hkdc1 UTSW 10 62411865 splice site probably benign
R0751:Hkdc1 UTSW 10 62398673 missense probably damaging 0.99
R1779:Hkdc1 UTSW 10 62391383 missense probably damaging 1.00
R1929:Hkdc1 UTSW 10 62417898 missense probably benign 0.01
R2271:Hkdc1 UTSW 10 62417898 missense probably benign 0.01
R3831:Hkdc1 UTSW 10 62400212 missense probably benign
R4480:Hkdc1 UTSW 10 62391372 missense probably benign
R4561:Hkdc1 UTSW 10 62409839 missense probably benign 0.00
R4576:Hkdc1 UTSW 10 62385843 missense possibly damaging 0.56
R4655:Hkdc1 UTSW 10 62400463 missense probably benign 0.09
R4723:Hkdc1 UTSW 10 62400354 missense probably benign 0.00
R4810:Hkdc1 UTSW 10 62411525 missense probably benign 0.08
R5086:Hkdc1 UTSW 10 62395274 intron probably benign
R5138:Hkdc1 UTSW 10 62398691 missense probably damaging 1.00
R5781:Hkdc1 UTSW 10 62417933 missense probably damaging 0.98
R5900:Hkdc1 UTSW 10 62408666 missense possibly damaging 0.91
R5982:Hkdc1 UTSW 10 62393810 missense probably benign
R6418:Hkdc1 UTSW 10 62383804 missense possibly damaging 0.93
R6612:Hkdc1 UTSW 10 62395441 missense possibly damaging 0.48
R6673:Hkdc1 UTSW 10 62403606 missense probably damaging 0.99
R6761:Hkdc1 UTSW 10 62408698 missense possibly damaging 0.93
R6915:Hkdc1 UTSW 10 62401932 missense possibly damaging 0.92
R7114:Hkdc1 UTSW 10 62393843 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATTCATTAGGTCTGGGCCTC -3'
(R):5'- GAAGGCCCCTCATGATTCCTTG -3'

Sequencing Primer
(F):5'- CCGTGCCTTTTATTTGGGAGCC -3'
(R):5'- CTCATGATTCCTTGCAGGGACAG -3'
Posted On2018-05-21