Incidental Mutation 'R6649:Abcc2'
ID527716
Institutional Source Beutler Lab
Gene Symbol Abcc2
Ensembl Gene ENSMUSG00000025194
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 2
Synonymsmultidrug resistance protein 2, Cmoat, Mrp2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6649 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location43782192-43840740 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43812502 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 627 (H627Q)
Ref Sequence ENSEMBL: ENSMUSP00000026208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026208]
Predicted Effect probably benign
Transcript: ENSMUST00000026208
AA Change: H627Q

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000026208
Gene: ENSMUSG00000025194
AA Change: H627Q

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 100 116 N/A INTRINSIC
transmembrane domain 128 150 N/A INTRINSIC
transmembrane domain 160 182 N/A INTRINSIC
Pfam:ABC_membrane 319 591 3.4e-37 PFAM
low complexity region 597 608 N/A INTRINSIC
AAA 661 836 1.77e-8 SMART
low complexity region 906 933 N/A INTRINSIC
Pfam:ABC_membrane 977 1249 5.4e-48 PFAM
AAA 1324 1509 1.33e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146737
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions in the canalicular surface of the hepatocyte and in biliary transport, and appears to contribute to drug resistance in mammalian cells. Several different mutations in the human gene have been observed in patients with Dubin-Johnson syndrome (DJS), an autosomal recessive disorder characterized by conjugated hyperbilirubinemia. Alternative splice variants have been observed for this gene; however, they have not been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have moderately enlarged livers, elevated plasma and urine bilirubin, and a reduced ability to clear various drugs and carcinogens from the blood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra G A 15: 41,869,233 L146F probably benign Het
Adamts7 T C 9: 90,191,937 C857R probably damaging Het
Ankhd1 A T 18: 36,600,783 probably null Het
Asb15 A G 6: 24,562,633 N198S probably benign Het
Asb16 A T 11: 102,269,037 Q72L possibly damaging Het
Bbox1 G T 2: 110,305,569 H22N probably benign Het
Bcdin3d T C 15: 99,470,815 T168A probably damaging Het
Bmp1 A T 14: 70,490,618 W624R probably damaging Het
C330027C09Rik A T 16: 49,017,466 Q843L probably damaging Het
Cdh18 A T 15: 23,436,534 Y492F possibly damaging Het
Cep290 A C 10: 100,518,531 D848A probably benign Het
Cmya5 G C 13: 93,098,025 S185C possibly damaging Het
Cops9 C T 1: 92,640,414 probably benign Het
Cutal C T 2: 34,885,921 T88I probably benign Het
Dlg4 G T 11: 70,023,953 probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Erp44 T C 4: 48,205,130 I288V probably null Het
Fam214a T G 9: 75,010,150 L677R probably damaging Het
Fat3 T C 9: 16,376,742 D495G probably damaging Het
Fsip2 T C 2: 82,967,817 V485A possibly damaging Het
Gm14496 A T 2: 181,997,476 H453L possibly damaging Het
Gm17027 T C 14: 42,159,279 T207A unknown Het
Gm6902 T G 7: 23,273,734 T123P possibly damaging Het
Gpat2 T G 2: 127,432,435 W366G possibly damaging Het
Heatr6 A T 11: 83,759,365 T216S probably benign Het
Hsd17b14 T C 7: 45,556,076 V11A probably damaging Het
Jak2 T A 19: 29,288,710 I517N probably benign Het
Kmt5b G A 19: 3,807,295 G351R probably damaging Het
Mau2 G T 8: 70,031,516 Q141K possibly damaging Het
Mfsd13a T C 19: 46,367,866 F137L probably damaging Het
Mfsd13a A G 19: 46,372,265 H394R probably benign Het
Mfsd14b A T 13: 65,066,785 I451N probably damaging Het
Milr1 C T 11: 106,757,711 H143Y probably benign Het
Mon2 T G 10: 123,038,480 K321T possibly damaging Het
Nlrp9c T A 7: 26,371,322 N945Y probably damaging Het
Nwd2 A G 5: 63,725,184 R60G possibly damaging Het
Olfr30 A T 11: 58,455,568 I127N probably damaging Het
Olfr44 A G 9: 39,484,752 V164A probably benign Het
Olfr691 T C 7: 105,337,707 H3R probably benign Het
Papola A T 12: 105,812,307 I315L possibly damaging Het
Phf3 A T 1: 30,805,023 S1618R possibly damaging Het
Phyhipl A G 10: 70,569,013 F77L probably damaging Het
Ppp3cb A G 14: 20,531,026 L110P probably damaging Het
Prss53 T G 7: 127,886,575 E531A probably benign Het
Raf1 A T 6: 115,631,341 H236Q probably benign Het
Ryr2 A G 13: 11,595,643 V4099A probably damaging Het
Sfxn3 G A 19: 45,049,915 probably null Het
Sh3pxd2b T C 11: 32,415,978 probably null Het
Slco6c1 C T 1: 97,125,711 S155N probably benign Het
Speer4f2 A G 5: 17,375,769 T115A probably benign Het
Spry1 T C 3: 37,642,722 I38T probably damaging Het
Tagap T C 17: 7,933,714 V577A probably benign Het
Ubr4 C A 4: 139,473,624 H4706Q possibly damaging Het
Vmn2r112 T A 17: 22,601,179 L11Q probably null Het
Zfp60 T C 7: 27,748,726 F273S probably benign Het
Zfp938 A T 10: 82,225,398 Y463N probably damaging Het
Other mutations in Abcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Abcc2 APN 19 43784202 missense probably benign 0.39
IGL01611:Abcc2 APN 19 43826629 missense probably damaging 1.00
IGL01800:Abcc2 APN 19 43784295 missense possibly damaging 0.78
IGL02008:Abcc2 APN 19 43821750 splice site probably benign
IGL02041:Abcc2 APN 19 43784235 missense probably damaging 1.00
IGL02528:Abcc2 APN 19 43798504 missense probably benign
IGL02950:Abcc2 APN 19 43825967 missense possibly damaging 0.83
IGL03081:Abcc2 APN 19 43782402 utr 5 prime probably benign
IGL03397:Abcc2 APN 19 43784304 missense probably benign 0.00
loser UTSW 19 43839411 utr 3 prime probably benign
nelson UTSW 19 43803739 missense probably benign 0.07
Sore UTSW 19 43798194 missense probably benign 0.22
PIT4453001:Abcc2 UTSW 19 43803782 nonsense probably null
PIT4519001:Abcc2 UTSW 19 43819397 missense possibly damaging 0.81
R0197:Abcc2 UTSW 19 43826614 nonsense probably null
R0326:Abcc2 UTSW 19 43825947 missense possibly damaging 0.90
R0391:Abcc2 UTSW 19 43821605 splice site probably benign
R0558:Abcc2 UTSW 19 43800724 missense probably benign 0.00
R0577:Abcc2 UTSW 19 43819401 missense probably damaging 1.00
R0787:Abcc2 UTSW 19 43798516 critical splice donor site probably null
R1189:Abcc2 UTSW 19 43819413 missense probably damaging 1.00
R1200:Abcc2 UTSW 19 43833987 missense probably damaging 0.98
R1395:Abcc2 UTSW 19 43833940 missense probably benign 0.22
R1606:Abcc2 UTSW 19 43836652 missense probably damaging 1.00
R1775:Abcc2 UTSW 19 43798419 missense possibly damaging 0.88
R1797:Abcc2 UTSW 19 43814786 missense possibly damaging 0.81
R1797:Abcc2 UTSW 19 43833987 missense probably damaging 0.98
R1826:Abcc2 UTSW 19 43822014 missense probably benign 0.01
R1882:Abcc2 UTSW 19 43798506 missense probably benign 0.00
R1913:Abcc2 UTSW 19 43807244 missense probably benign 0.10
R1986:Abcc2 UTSW 19 43829879 missense probably damaging 1.00
R1991:Abcc2 UTSW 19 43807142 missense probably damaging 1.00
R1992:Abcc2 UTSW 19 43807142 missense probably damaging 1.00
R2006:Abcc2 UTSW 19 43805061 missense probably damaging 1.00
R2057:Abcc2 UTSW 19 43818038 missense probably damaging 1.00
R3709:Abcc2 UTSW 19 43798446 missense possibly damaging 0.80
R3802:Abcc2 UTSW 19 43821626 missense probably benign 0.01
R4010:Abcc2 UTSW 19 43829864 missense possibly damaging 0.75
R4014:Abcc2 UTSW 19 43823120 missense probably benign
R4064:Abcc2 UTSW 19 43804993 nonsense probably null
R4296:Abcc2 UTSW 19 43823074 missense probably damaging 1.00
R4296:Abcc2 UTSW 19 43823075 missense probably damaging 1.00
R4363:Abcc2 UTSW 19 43799136 missense possibly damaging 0.94
R4580:Abcc2 UTSW 19 43811119 missense probably damaging 1.00
R4625:Abcc2 UTSW 19 43803739 missense probably benign 0.07
R4631:Abcc2 UTSW 19 43814707 missense possibly damaging 0.70
R4671:Abcc2 UTSW 19 43800718 missense probably benign
R4715:Abcc2 UTSW 19 43816882 missense possibly damaging 0.54
R4726:Abcc2 UTSW 19 43832114 missense probably benign 0.23
R4760:Abcc2 UTSW 19 43810481 missense probably benign 0.03
R4801:Abcc2 UTSW 19 43819361 missense probably damaging 1.00
R4802:Abcc2 UTSW 19 43819361 missense probably damaging 1.00
R4976:Abcc2 UTSW 19 43800635 missense probably benign 0.34
R5143:Abcc2 UTSW 19 43821661 missense probably benign 0.28
R5206:Abcc2 UTSW 19 43818150 missense probably damaging 1.00
R5376:Abcc2 UTSW 19 43829900 missense possibly damaging 0.76
R5478:Abcc2 UTSW 19 43839465 utr 3 prime probably benign
R5700:Abcc2 UTSW 19 43798194 missense probably benign 0.22
R5863:Abcc2 UTSW 19 43798136 missense probably benign 0.00
R5928:Abcc2 UTSW 19 43819358 missense probably damaging 1.00
R5955:Abcc2 UTSW 19 43813190 missense probably damaging 0.98
R5983:Abcc2 UTSW 19 43819503 missense probably benign
R6014:Abcc2 UTSW 19 43826735 missense probably benign
R6419:Abcc2 UTSW 19 43837508 unclassified probably null
R6497:Abcc2 UTSW 19 43805105 missense probably damaging 1.00
R6510:Abcc2 UTSW 19 43782206 utr 5 prime probably null
R6614:Abcc2 UTSW 19 43819361 missense probably benign 0.01
R6653:Abcc2 UTSW 19 43812502 missense probably benign 0.05
R6670:Abcc2 UTSW 19 43839411 utr 3 prime probably benign
R6964:Abcc2 UTSW 19 43798076 missense probably benign 0.12
R6989:Abcc2 UTSW 19 43832172 missense probably damaging 1.00
R7015:Abcc2 UTSW 19 43798178 missense probably benign 0.03
R7026:Abcc2 UTSW 19 43816953 missense probably benign 0.00
R7026:Abcc2 UTSW 19 43830535 missense probably benign 0.01
R7136:Abcc2 UTSW 19 43837460 missense probably damaging 1.00
R7252:Abcc2 UTSW 19 43827949 missense probably damaging 0.98
R7293:Abcc2 UTSW 19 43807053 missense probably damaging 1.00
R7392:Abcc2 UTSW 19 43808687 missense probably damaging 0.97
R7450:Abcc2 UTSW 19 43822039 missense probably damaging 1.00
X0025:Abcc2 UTSW 19 43832205 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTGTGGCAAAGTCATGGCTAATG -3'
(R):5'- AGCTGTTTTGCTTAGAAATCTGGC -3'

Sequencing Primer
(F):5'- CCATAAGGGCAACTCTTTATTAAGTG -3'
(R):5'- TTTGCTTAGAAATCTGGCTAAGTAC -3'
Posted On2018-07-23