Incidental Mutation 'R6985:Lrrc55'
ID542887
Institutional Source Beutler Lab
Gene Symbol Lrrc55
Ensembl Gene ENSMUSG00000075224
Gene Nameleucine rich repeat containing 55
SynonymsLOC241528, A330097E02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6985 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location85162334-85196699 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 85191930 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Histidine at position 306 (N306H)
Ref Sequence ENSEMBL: ENSMUSP00000107228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099930] [ENSMUST00000111601]
Predicted Effect probably benign
Transcript: ENSMUST00000099930
AA Change: N306H

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097514
Gene: ENSMUSG00000075224
AA Change: N306H

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
LRRNT 50 82 2.57e-7 SMART
LRR 103 124 3.29e-1 SMART
LRR 126 148 4.7e0 SMART
LRR 150 173 2.47e2 SMART
LRR 174 197 2.4e1 SMART
LRRCT 209 263 6.85e-9 SMART
transmembrane domain 272 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111601
AA Change: N306H

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107228
Gene: ENSMUSG00000075224
AA Change: N306H

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
LRRNT 50 82 2.57e-7 SMART
LRR 103 124 3.29e-1 SMART
LRR 126 148 4.7e0 SMART
LRR 150 173 2.47e2 SMART
LRR 174 197 2.4e1 SMART
LRRCT 209 263 6.85e-9 SMART
transmembrane domain 272 294 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akirin1 A G 4: 123,736,856 *192R probably null Het
Ankar A C 1: 72,658,482 L836R probably damaging Het
Anxa7 G T 14: 20,471,568 A20E unknown Het
Arhgap1 T A 2: 91,668,198 Y147N probably damaging Het
Arid2 T C 15: 96,370,148 V714A probably benign Het
Arrdc3 T C 13: 80,883,657 L3P probably damaging Het
Bhmt2 T C 13: 93,663,322 D202G possibly damaging Het
Bub1b A G 2: 118,606,614 R98G probably damaging Het
Capn10 T C 1: 92,943,424 Y319H probably damaging Het
Cep95 T C 11: 106,818,703 F115S probably damaging Het
Chsy3 A T 18: 59,176,488 probably null Het
Cnot1 T C 8: 95,734,129 N1755S probably benign Het
Cntn4 A G 6: 106,679,417 N893S probably benign Het
Ctsh G A 9: 90,054,604 A19T possibly damaging Het
Cttn C A 7: 144,452,587 E214* probably null Het
Des A G 1: 75,366,787 E438G possibly damaging Het
Dnaja4 T C 9: 54,708,395 V109A probably benign Het
Dock1 A G 7: 135,163,403 E1708G possibly damaging Het
Dst T C 1: 34,190,853 I2184T probably benign Het
Enc1 C T 13: 97,245,120 T46I possibly damaging Het
Etaa1 A G 11: 17,946,108 S670P probably damaging Het
Fam168b G A 1: 34,819,708 T131M probably damaging Het
Fbn2 A T 18: 58,068,388 V1319E probably damaging Het
Fcrl1 T A 3: 87,389,650 V302E probably benign Het
Fgfr3 G C 5: 33,735,441 E744Q probably null Het
Gmps T A 3: 64,015,539 I641N probably damaging Het
Gpc2 T A 5: 138,278,408 Y152F probably damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Herc2 A G 7: 56,132,480 D1305G probably damaging Het
Ighv1-37 T C 12: 114,896,632 T14A probably benign Het
Insr T A 8: 3,161,372 M1156L possibly damaging Het
Kirrel2 C A 7: 30,455,306 G127C probably damaging Het
Krt10 T C 11: 99,385,630 N65S possibly damaging Het
Lrig3 A G 10: 126,014,869 I1101M possibly damaging Het
Map4k3 A G 17: 80,636,732 S329P probably damaging Het
Mapkap1 T G 2: 34,432,110 H13Q probably damaging Het
Mki67 A G 7: 135,713,865 L60S probably damaging Het
Muc4 A T 16: 32,751,999 M626L probably benign Het
Mycbp2 C T 14: 103,206,681 V1914I possibly damaging Het
Myo5b T C 18: 74,653,361 F442L possibly damaging Het
Naa35 T A 13: 59,627,943 M545K probably benign Het
Nrxn2 T A 19: 6,481,245 V645E probably damaging Het
Olfr313 T C 11: 58,817,113 F35S probably damaging Het
Olfr619 A G 7: 103,603,668 T5A probably benign Het
Otx1 A T 11: 21,996,615 Y231* probably null Het
Pcdhb19 A G 18: 37,497,158 E2G probably benign Het
Pik3c2a G A 7: 116,417,988 T178I probably damaging Het
Plxna4 A G 6: 32,237,708 S613P probably damaging Het
Pon1 T G 6: 5,168,345 D354A probably benign Het
Prtg T G 9: 72,851,501 I379S probably damaging Het
Rbm17 T G 2: 11,590,693 M234L probably benign Het
Rex1bd T C 8: 70,505,905 S71G probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Shank1 A G 7: 44,344,913 I833V unknown Het
Slc35f1 C A 10: 53,021,911 D139E probably benign Het
Spata31d1a T C 13: 59,703,093 N407S probably benign Het
Spata31d1d T A 13: 59,731,615 I36F probably benign Het
Sstr4 T A 2: 148,396,249 M260K probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trat1 A G 16: 48,754,271 Y55H probably damaging Het
Vcan T C 13: 89,679,956 T3124A probably damaging Het
Wdfy4 A T 14: 33,099,117 F1385Y possibly damaging Het
Xrcc3 T C 12: 111,812,096 D7G probably damaging Het
Other mutations in Lrrc55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Lrrc55 APN 2 85196215 missense possibly damaging 0.53
IGL01646:Lrrc55 APN 2 85191989 missense probably damaging 0.99
R0149:Lrrc55 UTSW 2 85196245 missense probably damaging 0.98
R0361:Lrrc55 UTSW 2 85196245 missense probably damaging 0.98
R0491:Lrrc55 UTSW 2 85191920 missense probably damaging 1.00
R4223:Lrrc55 UTSW 2 85196116 missense possibly damaging 0.82
R4654:Lrrc55 UTSW 2 85196536 missense possibly damaging 0.82
R4746:Lrrc55 UTSW 2 85196170 missense probably damaging 1.00
R5756:Lrrc55 UTSW 2 85196383 missense probably benign 0.34
R6329:Lrrc55 UTSW 2 85196309 missense probably benign 0.28
R6705:Lrrc55 UTSW 2 85196355 missense probably benign 0.33
R7229:Lrrc55 UTSW 2 85196440 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTCAGAGTATTGGCATTTTGTC -3'
(R):5'- TGTTGCAGATTCTCAGCTTGC -3'

Sequencing Primer
(F):5'- TCAGTTGCTAGCACAGTGC -3'
(R):5'- TGAAGTTGAGGGTGCCCC -3'
Posted On2018-11-28