Incidental Mutation 'R6985:Insr'
ID542909
Institutional Source Beutler Lab
Gene Symbol Insr
Ensembl Gene ENSMUSG00000005534
Gene Nameinsulin receptor
SynonymsIR-A, IR-B, D630014A15Rik, 4932439J01Rik, IR, CD220
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.825) question?
Stock #R6985 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location3122061-3279617 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3161372 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1156 (M1156L)
Ref Sequence ENSEMBL: ENSMUSP00000088837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091291]
PDB Structure
1.35A crystal structure of H-2Kb complexed with the GNYSFYAL peptide [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091291
AA Change: M1156L

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088837
Gene: ENSMUSG00000005534
AA Change: M1156L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Recep_L_domain 52 164 5e-28 PFAM
FU 231 274 1.66e-10 SMART
Pfam:Recep_L_domain 359 473 2.5e-30 PFAM
FN3 496 602 4.02e1 SMART
FN3 624 821 1.16e-6 SMART
FN3 841 924 3.17e-4 SMART
transmembrane domain 947 969 N/A INTRINSIC
TyrKc 1013 1280 3.11e-134 SMART
low complexity region 1303 1315 N/A INTRINSIC
low complexity region 1327 1336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208839
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: This gene encodes a member of the receptor tyrosine kinase family of transmembrane signaling proteins that play important roles in cell differentiation, growth and metabolism. The encoded preproprotein undergoes proteolytic processing to generate alpha and beta chains that form a disulfide-linked heterodimer which, in turn homodimerizes to form a mature, functional receptor. Mice lacking the encoded protein develop severe hyperglycemia and hyperketonemia, and die within a couple of days after birth as a result of diabetic ketoacidosis. [provided by RefSeq, Aug 2016]
PHENOTYPE: Null mutants grow slowly and die by 7 days of age with ketoacidosis, high serum insulin and triglycerides, low glycogen stores and fatty livers. Tissue specific knockouts show milder lipid metabolism anomalies. Point mutation heterozygotes exhibit hyperglycemia, hyperinsulinemia and glucosuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akirin1 A G 4: 123,736,856 *192R probably null Het
Ankar A C 1: 72,658,482 L836R probably damaging Het
Anxa7 G T 14: 20,471,568 A20E unknown Het
Arhgap1 T A 2: 91,668,198 Y147N probably damaging Het
Arid2 T C 15: 96,370,148 V714A probably benign Het
Arrdc3 T C 13: 80,883,657 L3P probably damaging Het
Bhmt2 T C 13: 93,663,322 D202G possibly damaging Het
Bub1b A G 2: 118,606,614 R98G probably damaging Het
Capn10 T C 1: 92,943,424 Y319H probably damaging Het
Cep95 T C 11: 106,818,703 F115S probably damaging Het
Chsy3 A T 18: 59,176,488 probably null Het
Cnot1 T C 8: 95,734,129 N1755S probably benign Het
Cntn4 A G 6: 106,679,417 N893S probably benign Het
Ctsh G A 9: 90,054,604 A19T possibly damaging Het
Cttn C A 7: 144,452,587 E214* probably null Het
Des A G 1: 75,366,787 E438G possibly damaging Het
Dnaja4 T C 9: 54,708,395 V109A probably benign Het
Dock1 A G 7: 135,163,403 E1708G possibly damaging Het
Dst T C 1: 34,190,853 I2184T probably benign Het
Enc1 C T 13: 97,245,120 T46I possibly damaging Het
Etaa1 A G 11: 17,946,108 S670P probably damaging Het
Fam168b G A 1: 34,819,708 T131M probably damaging Het
Fbn2 A T 18: 58,068,388 V1319E probably damaging Het
Fcrl1 T A 3: 87,389,650 V302E probably benign Het
Fgfr3 G C 5: 33,735,441 E744Q probably null Het
Gmps T A 3: 64,015,539 I641N probably damaging Het
Gpc2 T A 5: 138,278,408 Y152F probably damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Herc2 A G 7: 56,132,480 D1305G probably damaging Het
Ighv1-37 T C 12: 114,896,632 T14A probably benign Het
Kirrel2 C A 7: 30,455,306 G127C probably damaging Het
Krt10 T C 11: 99,385,630 N65S possibly damaging Het
Lrig3 A G 10: 126,014,869 I1101M possibly damaging Het
Lrrc55 T G 2: 85,191,930 N306H probably benign Het
Map4k3 A G 17: 80,636,732 S329P probably damaging Het
Mapkap1 T G 2: 34,432,110 H13Q probably damaging Het
Mki67 A G 7: 135,713,865 L60S probably damaging Het
Muc4 A T 16: 32,751,999 M626L probably benign Het
Mycbp2 C T 14: 103,206,681 V1914I possibly damaging Het
Myo5b T C 18: 74,653,361 F442L possibly damaging Het
Naa35 T A 13: 59,627,943 M545K probably benign Het
Nrxn2 T A 19: 6,481,245 V645E probably damaging Het
Olfr313 T C 11: 58,817,113 F35S probably damaging Het
Olfr619 A G 7: 103,603,668 T5A probably benign Het
Otx1 A T 11: 21,996,615 Y231* probably null Het
Pcdhb19 A G 18: 37,497,158 E2G probably benign Het
Pik3c2a G A 7: 116,417,988 T178I probably damaging Het
Plxna4 A G 6: 32,237,708 S613P probably damaging Het
Pon1 T G 6: 5,168,345 D354A probably benign Het
Prtg T G 9: 72,851,501 I379S probably damaging Het
Rbm17 T G 2: 11,590,693 M234L probably benign Het
Rex1bd T C 8: 70,505,905 S71G probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Shank1 A G 7: 44,344,913 I833V unknown Het
Slc35f1 C A 10: 53,021,911 D139E probably benign Het
Spata31d1a T C 13: 59,703,093 N407S probably benign Het
Spata31d1d T A 13: 59,731,615 I36F probably benign Het
Sstr4 T A 2: 148,396,249 M260K probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trat1 A G 16: 48,754,271 Y55H probably damaging Het
Vcan T C 13: 89,679,956 T3124A probably damaging Het
Wdfy4 A T 14: 33,099,117 F1385Y possibly damaging Het
Xrcc3 T C 12: 111,812,096 D7G probably damaging Het
Other mutations in Insr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Insr APN 8 3258682 missense probably damaging 1.00
IGL01986:Insr APN 8 3158817 missense probably damaging 1.00
IGL02135:Insr APN 8 3258741 missense probably damaging 1.00
IGL02203:Insr APN 8 3155817 missense probably benign 0.18
IGL02220:Insr APN 8 3159578 missense probably damaging 1.00
IGL02678:Insr APN 8 3173570 missense probably benign 0.00
IGL02961:Insr APN 8 3258785 missense probably benign 0.08
IGL03099:Insr APN 8 3258715 missense probably damaging 1.00
IGL03125:Insr APN 8 3184972 missense possibly damaging 0.87
IGL03290:Insr APN 8 3258574 missense probably damaging 1.00
gummi_bear UTSW 8 3161770 missense probably damaging 1.00
Patently UTSW 8 3159475 missense probably damaging 1.00
trolli UTSW 8 3198111 missense probably benign 0.31
R0047:Insr UTSW 8 3202947 missense probably damaging 0.97
R0053:Insr UTSW 8 3155683 missense probably damaging 1.00
R0053:Insr UTSW 8 3155683 missense probably damaging 1.00
R0480:Insr UTSW 8 3161770 missense probably damaging 1.00
R0748:Insr UTSW 8 3258841 missense probably damaging 1.00
R0919:Insr UTSW 8 3158769 missense probably damaging 1.00
R1348:Insr UTSW 8 3192635 missense probably damaging 1.00
R1467:Insr UTSW 8 3169720 missense probably damaging 0.99
R1467:Insr UTSW 8 3169720 missense probably damaging 0.99
R1568:Insr UTSW 8 3165576 missense probably benign
R1768:Insr UTSW 8 3159561 missense probably damaging 1.00
R2093:Insr UTSW 8 3204762 missense probably damaging 1.00
R2111:Insr UTSW 8 3169748 missense probably benign 0.17
R2112:Insr UTSW 8 3169748 missense probably benign 0.17
R2352:Insr UTSW 8 3192593 missense probably damaging 1.00
R2364:Insr UTSW 8 3174820 missense probably benign
R2842:Insr UTSW 8 3202986 missense probably damaging 1.00
R3162:Insr UTSW 8 3161416 missense possibly damaging 0.65
R3162:Insr UTSW 8 3161416 missense possibly damaging 0.65
R4081:Insr UTSW 8 3211391 missense probably benign 0.00
R4441:Insr UTSW 8 3194902 missense probably benign 0.00
R4672:Insr UTSW 8 3167501 critical splice donor site probably null
R4687:Insr UTSW 8 3161709 missense probably benign 0.42
R4708:Insr UTSW 8 3211346 intron probably benign
R4890:Insr UTSW 8 3198234 missense probably benign 0.16
R4949:Insr UTSW 8 3185059 missense probably benign 0.04
R4996:Insr UTSW 8 3192665 missense probably null 0.98
R5073:Insr UTSW 8 3159475 missense probably damaging 1.00
R5176:Insr UTSW 8 3158742 missense probably benign 0.03
R5200:Insr UTSW 8 3198059 critical splice donor site probably null
R5323:Insr UTSW 8 3202902 missense probably benign 0.02
R5453:Insr UTSW 8 3155694 missense probably benign 0.06
R5516:Insr UTSW 8 3155764 nonsense probably null
R5704:Insr UTSW 8 3185122 missense possibly damaging 0.52
R5820:Insr UTSW 8 3155976 missense probably damaging 1.00
R5879:Insr UTSW 8 3198173 nonsense probably null
R5894:Insr UTSW 8 3174869 missense possibly damaging 0.88
R5937:Insr UTSW 8 3174808 missense probably benign
R5966:Insr UTSW 8 3258697 missense probably benign 0.04
R6134:Insr UTSW 8 3192572 missense probably damaging 1.00
R6352:Insr UTSW 8 3173479 critical splice donor site probably null
R6423:Insr UTSW 8 3173566 missense probably benign
R6687:Insr UTSW 8 3198111 missense probably benign 0.31
R6993:Insr UTSW 8 3258752 missense probably damaging 1.00
R7041:Insr UTSW 8 3258418 missense probably benign
R7109:Insr UTSW 8 3258481 missense probably benign 0.33
R7216:Insr UTSW 8 3203034 missense possibly damaging 0.53
R7287:Insr UTSW 8 3169717 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATTTAGGACCCAAGAATCTGCC -3'
(R):5'- AGATGGAATCAGAGTGCTAATTGC -3'

Sequencing Primer
(F):5'- GACCCAAGAATCTGCCATGCC -3'
(R):5'- AATTGCAACCCCTGTTTTGACTTTAG -3'
Posted On2018-11-28