Incidental Mutation 'PIT4514001:Foxb1'
ID556276
Institutional Source Beutler Lab
Gene Symbol Foxb1
Ensembl Gene ENSMUSG00000059246
Gene Nameforkhead box B1
SynonymsTWH, Mf3, C43, Foxb1b, Hfh-e5.1, Foxb1a, Fkh5
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.706) question?
Stock #PIT4514001 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location69757710-69760940 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69760221 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 9 (Y9F)
Ref Sequence ENSEMBL: ENSMUSP00000096197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071281]
Predicted Effect probably damaging
Transcript: ENSMUST00000071281
AA Change: Y9F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096197
Gene: ENSMUSG00000059246
AA Change: Y9F

DomainStartEndE-ValueType
FH 11 101 6.75e-62 SMART
low complexity region 102 113 N/A INTRINSIC
low complexity region 265 309 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.6%
  • 10x: 84.2%
  • 20x: 70.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Targeted null mutant mice show variable embryonic lethality with neural tube defects or severe posterior reduction. Survivors have high postnatal mortality, reduced growth, motor weakness, midbrain abnormalities and females have a lactational defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik T A 5: 98,801,871 H221Q probably benign Het
1700023F06Rik T C 11: 103,201,134 D27G probably benign Het
4930486L24Rik A G 13: 60,853,514 probably null Het
Abcc10 T A 17: 46,305,648 I1247F probably benign Het
Acap3 G A 4: 155,903,378 A524T probably benign Het
Adcy10 T A 1: 165,556,791 N1040K probably benign Het
Adrb2 T C 18: 62,179,727 D9G probably benign Het
Aldh1a7 T C 19: 20,702,240 T391A probably benign Het
Bcam A G 7: 19,764,066 V344A probably benign Het
Birc7 T A 2: 180,931,306 I172N possibly damaging Het
Cfap126 G A 1: 171,125,312 D45N probably damaging Het
Cit G A 5: 115,997,854 probably null Het
Col26a1 A G 5: 136,751,725 V295A probably benign Het
Epha7 C T 4: 28,961,355 Q867* probably null Het
Fn1 A G 1: 71,628,456 S793P probably benign Het
Gm13124 T C 4: 144,555,511 Y237C probably damaging Het
Gpc1 T A 1: 92,857,557 M406K probably benign Het
Gsg1 T C 6: 135,237,576 T312A probably benign Het
Hmcn1 T A 1: 150,669,487 I2790F possibly damaging Het
Kcnma1 C T 14: 23,309,035 probably null Het
Lmntd1 AGACTGTAAGTTTCTCAAATGTGTACCTGGA AGA 6: 145,427,253 probably null Het
Mcph1 A G 8: 18,631,890 K348E probably damaging Het
Olfr122 T A 17: 37,771,867 N71K probably damaging Het
Olfr985 T C 9: 40,127,299 I221V probably damaging Het
Pik3cg T A 12: 32,204,903 R362W probably damaging Het
Pkp3 T C 7: 141,089,710 L765P probably damaging Het
Plxna2 A T 1: 194,794,937 I1252F probably benign Het
Prpf8 T C 11: 75,496,355 F1154S possibly damaging Het
Scn7a A G 2: 66,684,179 F1084L probably damaging Het
Shmt1 G A 11: 60,804,347 S47L probably damaging Het
Snap91 T C 9: 86,879,433 K40R possibly damaging Het
Spag17 A T 3: 100,013,211 T421S possibly damaging Het
Speer4f1 T A 5: 17,478,756 N139K possibly damaging Het
Syne2 T G 12: 76,105,015 N1883K probably damaging Het
Tgfb1i1 C T 7: 128,249,181 R191C probably damaging Het
Tmem39b A C 4: 129,684,497 N310K possibly damaging Het
Trim3 T C 7: 105,618,210 T321A probably benign Het
Vmn2r124 T C 17: 18,073,712 I687T probably benign Het
Zbtb8a T C 4: 129,357,730 D316G probably benign Het
Zfp639 A G 3: 32,520,260 I345V possibly damaging Het
Zfp764 T C 7: 127,404,741 H406R probably benign Het
Other mutations in Foxb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Foxb1 APN 9 69760198 missense probably damaging 1.00
IGL01475:Foxb1 APN 9 69759268 utr 3 prime probably benign
IGL02153:Foxb1 APN 9 69759703 missense probably benign 0.00
R0570:Foxb1 UTSW 9 69759562 missense probably benign
R1618:Foxb1 UTSW 9 69760011 missense probably damaging 0.96
R1624:Foxb1 UTSW 9 69759316 missense probably benign 0.04
R1665:Foxb1 UTSW 9 69759822 missense probably damaging 0.97
R1913:Foxb1 UTSW 9 69760101 missense possibly damaging 0.51
R2243:Foxb1 UTSW 9 69759864 missense probably damaging 0.99
R4913:Foxb1 UTSW 9 69759577 missense probably benign
R4925:Foxb1 UTSW 9 69760155 missense probably damaging 1.00
R5630:Foxb1 UTSW 9 69760120 missense probably damaging 1.00
R5668:Foxb1 UTSW 9 69760246 start codon destroyed probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCGGGATCTTGATGAAGCAATC -3'
(R):5'- AAAGTTGCTGGCACCCGAATC -3'

Sequencing Primer
(F):5'- TCTTGATGAAGCAATCGTTGAAGG -3'
(R):5'- TGGCACCCGAATCCCCTC -3'
Posted On2019-06-07