Incidental Mutation 'R7209:Psd4'
ID560917
Institutional Source Beutler Lab
Gene Symbol Psd4
Ensembl Gene ENSMUSG00000026979
Gene Namepleckstrin and Sec7 domain containing 4
SynonymsSEC7 homolog, EFA6B
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7209 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location24367580-24414954 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24397345 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 430 (S430P)
Ref Sequence ENSEMBL: ENSMUSP00000062415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056641] [ENSMUST00000102942] [ENSMUST00000127242] [ENSMUST00000131930] [ENSMUST00000140303] [ENSMUST00000140547] [ENSMUST00000142522] [ENSMUST00000166388]
Predicted Effect probably damaging
Transcript: ENSMUST00000056641
AA Change: S430P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000062415
Gene: ENSMUSG00000026979
AA Change: S430P

DomainStartEndE-ValueType
low complexity region 156 176 N/A INTRINSIC
low complexity region 350 361 N/A INTRINSIC
low complexity region 420 438 N/A INTRINSIC
low complexity region 458 474 N/A INTRINSIC
Sec7 497 688 9.39e-47 SMART
PH 727 843 1.1e-10 SMART
low complexity region 883 893 N/A INTRINSIC
low complexity region 897 920 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102942
AA Change: S430P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000100006
Gene: ENSMUSG00000026979
AA Change: S430P

DomainStartEndE-ValueType
low complexity region 156 176 N/A INTRINSIC
low complexity region 350 361 N/A INTRINSIC
low complexity region 420 438 N/A INTRINSIC
low complexity region 458 474 N/A INTRINSIC
Sec7 497 688 9.39e-47 SMART
PH 727 843 1.1e-10 SMART
low complexity region 883 893 N/A INTRINSIC
low complexity region 897 920 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127242
Predicted Effect probably benign
Transcript: ENSMUST00000131930
Predicted Effect probably benign
Transcript: ENSMUST00000140303
Predicted Effect probably benign
Transcript: ENSMUST00000140547
Predicted Effect probably benign
Transcript: ENSMUST00000142522
Predicted Effect probably damaging
Transcript: ENSMUST00000166388
AA Change: S430P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132395
Gene: ENSMUSG00000026979
AA Change: S430P

DomainStartEndE-ValueType
low complexity region 156 176 N/A INTRINSIC
low complexity region 350 361 N/A INTRINSIC
low complexity region 420 438 N/A INTRINSIC
low complexity region 458 474 N/A INTRINSIC
Sec7 497 688 9.39e-47 SMART
PH 727 843 1.1e-10 SMART
low complexity region 883 893 N/A INTRINSIC
low complexity region 897 920 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,750,357 P1136T probably damaging Het
4933428G20Rik G C 11: 97,492,447 probably null Het
Adam7 A G 14: 68,529,819 Y61H probably damaging Het
Adgrb1 T G 15: 74,569,948 V966G possibly damaging Het
Adh5 G A 3: 138,443,148 probably benign Het
Akr1b8 T C 6: 34,356,272 V28A probably damaging Het
Apbb1 T A 7: 105,566,085 I450F probably damaging Het
Arhgap23 C T 11: 97,476,085 T1064I probably damaging Het
Atg4b A G 1: 93,775,233 I128M probably damaging Het
B230118H07Rik T C 2: 101,566,382 *217W probably null Het
Baat A T 4: 49,503,065 I19N probably damaging Het
Bspry T G 4: 62,486,615 I216S possibly damaging Het
Commd9 T A 2: 101,895,138 S19T possibly damaging Het
Cr2 A G 1: 195,168,724 C145R probably damaging Het
Cyp2c68 A G 19: 39,689,205 L447P probably damaging Het
Depdc1b T C 13: 108,382,855 M333T possibly damaging Het
Dhx9 T C 1: 153,464,623 T710A possibly damaging Het
Dnah5 T C 15: 28,459,225 V4530A possibly damaging Het
Dohh T A 10: 81,386,040 H89Q probably damaging Het
Dopey2 T A 16: 93,769,845 N1171K probably benign Het
Dscam T C 16: 96,650,344 probably null Het
Entpd5 T A 12: 84,396,928 S14C probably benign Het
Eqtn G A 4: 94,925,569 S125F probably damaging Het
Erp44 A T 4: 48,211,704 D197E probably benign Het
Fgf18 A T 11: 33,134,315 D46E probably benign Het
Foxa1 T A 12: 57,543,291 M48L probably benign Het
Gabrg1 C A 5: 70,754,170 C417F probably damaging Het
Glrp1 T A 1: 88,503,282 Q122L unknown Het
Gm5286 A T 3: 94,198,705 Q110L probably benign Het
Gm5622 A G 14: 51,655,906 I97V possibly damaging Het
Gusb A G 5: 129,998,546 V306A probably benign Het
Hars A G 18: 36,773,540 S126P probably benign Het
Herc1 A G 9: 66,385,032 S356G possibly damaging Het
Hydin C A 8: 110,489,792 Y1336* probably null Het
Kin T C 2: 10,091,753 Y138H possibly damaging Het
Lypd2 C T 15: 74,732,417 V101M probably benign Het
Madcam1 A T 10: 79,665,058 T70S possibly damaging Het
Man1a2 A G 3: 100,647,079 C112R unknown Het
Mia2 T A 12: 59,154,390 V198E possibly damaging Het
Mpdz C T 4: 81,306,877 V1438M possibly damaging Het
Mtif2 G A 11: 29,529,996 V21M probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nln G A 13: 104,072,898 Q56* probably null Het
Nlrp4b T C 7: 10,710,370 V82A probably benign Het
Obscn C A 11: 59,085,107 E2065* probably null Het
Olfr1510 A G 14: 52,410,093 C260R possibly damaging Het
Pilrb2 C T 5: 137,870,864 probably null Het
Plekhh1 C A 12: 79,050,376 D99E probably benign Het
Polr2b T A 5: 77,343,179 F956I probably damaging Het
Ppp3cc A G 14: 70,267,498 F20L probably benign Het
Prmt9 T C 8: 77,564,998 V333A probably benign Het
Rrp12 A C 19: 41,872,949 V973G possibly damaging Het
Rxfp2 A G 5: 150,053,098 probably null Het
S100a6 G A 3: 90,613,788 A8T possibly damaging Het
Sgsm2 C A 11: 74,854,325 G717V probably damaging Het
Sipa1 A G 19: 5,654,975 Y531H probably damaging Het
Slc45a1 A C 4: 150,635,212 probably null Het
Srbd1 C A 17: 86,001,520 L743F probably damaging Het
Taar2 A T 10: 23,940,699 I46F possibly damaging Het
Tcrg-C3 A G 13: 19,261,164 N94S probably benign Het
Tmem241 A T 18: 12,104,172 V69D probably damaging Het
Tns1 T C 1: 73,953,915 S535G possibly damaging Het
Ttc34 C A 4: 154,839,128 P98Q probably damaging Het
Ubr1 C A 2: 120,862,765 R1720L probably benign Het
Ubr3 T A 2: 70,016,134 D1597E probably benign Het
Unc79 T C 12: 103,125,624 M1930T probably benign Het
Vmn2r100 A T 17: 19,531,314 I603F not run Het
Vps26b A T 9: 27,009,992 S304T probably benign Het
Zfp952 A T 17: 33,003,470 T308S possibly damaging Het
Other mutations in Psd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Psd4 APN 2 24394286 missense probably benign 0.25
IGL01302:Psd4 APN 2 24396787 critical splice donor site probably null
IGL01446:Psd4 APN 2 24405395 missense probably damaging 1.00
IGL01577:Psd4 APN 2 24403222 missense probably damaging 0.96
IGL01823:Psd4 APN 2 24394432 missense probably benign 0.27
IGL02103:Psd4 APN 2 24400528 nonsense probably null
IGL02212:Psd4 APN 2 24405314 nonsense probably null
IGL02240:Psd4 APN 2 24396377 missense probably benign 0.00
IGL02261:Psd4 APN 2 24401744 missense probably damaging 1.00
IGL02345:Psd4 APN 2 24401823 critical splice donor site probably null
IGL03272:Psd4 APN 2 24405680 splice site probably benign
bitcoin UTSW 2 24401557 missense probably damaging 1.00
crypto UTSW 2 24397247 missense probably benign
underworld UTSW 2 24405351 missense probably damaging 1.00
PIT4469001:Psd4 UTSW 2 24394294 missense probably benign 0.08
R0131:Psd4 UTSW 2 24405351 missense probably damaging 1.00
R0131:Psd4 UTSW 2 24405351 missense probably damaging 1.00
R0132:Psd4 UTSW 2 24405351 missense probably damaging 1.00
R0278:Psd4 UTSW 2 24394438 missense probably damaging 1.00
R1303:Psd4 UTSW 2 24395018 missense probably benign 0.00
R1551:Psd4 UTSW 2 24403280 missense probably benign 0.02
R1715:Psd4 UTSW 2 24405332 missense probably damaging 1.00
R1854:Psd4 UTSW 2 24397456 missense probably benign 0.26
R1942:Psd4 UTSW 2 24405793 missense probably damaging 1.00
R2392:Psd4 UTSW 2 24394667 missense probably damaging 0.98
R2420:Psd4 UTSW 2 24401241 missense probably damaging 1.00
R4509:Psd4 UTSW 2 24396335 missense probably benign
R4512:Psd4 UTSW 2 24402889 missense probably damaging 1.00
R4558:Psd4 UTSW 2 24404794 missense probably damaging 1.00
R4995:Psd4 UTSW 2 24397247 missense probably benign
R5120:Psd4 UTSW 2 24405438 missense probably benign
R5314:Psd4 UTSW 2 24400516 missense possibly damaging 0.89
R5563:Psd4 UTSW 2 24394885 missense probably benign
R5638:Psd4 UTSW 2 24397415 missense probably benign 0.14
R6191:Psd4 UTSW 2 24394487 missense probably damaging 1.00
R6224:Psd4 UTSW 2 24401557 missense probably damaging 1.00
R7024:Psd4 UTSW 2 24394543 missense possibly damaging 0.76
R7046:Psd4 UTSW 2 24394973 missense probably benign 0.05
R7483:Psd4 UTSW 2 24404756 missense possibly damaging 0.65
X0009:Psd4 UTSW 2 24401525 missense probably damaging 1.00
X0064:Psd4 UTSW 2 24404738 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCCAATCCTGAGCATGCTC -3'
(R):5'- TGAGACTCACCCTTCTGCAG -3'

Sequencing Primer
(F):5'- GAGCATGCTCATTTCTGCTG -3'
(R):5'- GAAGCATCTTCACTTCTGGATG -3'
Posted On2019-06-26