Incidental Mutation 'R0386:Pglyrp2'
ID65511
Institutional Source Beutler Lab
Gene Symbol Pglyrp2
Ensembl Gene ENSMUSG00000079563
Gene Namepeptidoglycan recognition protein 2
SynonymstagL-alpha, PGRP-L, tagl-beta, tagL, C730002N09Rik, Pglyrpl
MMRRC Submission 038592-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0386 (G1)
Quality Score153
Status Validated
Chromosome17
Chromosomal Location32413100-32424167 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 32420862 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000129964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114455] [ENSMUST00000170392]
Predicted Effect probably null
Transcript: ENSMUST00000114455
AA Change: M1T

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110099
Gene: ENSMUSG00000079563
AA Change: M1T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 251 266 N/A INTRINSIC
low complexity region 270 281 N/A INTRINSIC
PGRP 360 506 6.61e-78 SMART
Ami_2 373 512 6.28e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000170392
AA Change: M1T

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129964
Gene: ENSMUSG00000079563
AA Change: M1T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 251 266 N/A INTRINSIC
low complexity region 270 281 N/A INTRINSIC
PGRP 360 506 6.61e-78 SMART
Ami_2 373 512 6.28e-10 SMART
Meta Mutation Damage Score 0.6248 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a peptidoglycan recognition protein, which belongs to the N-acetylmuramoyl-L-alanine amidase 2 family. This protein hydrolyzes the link between N-acetylmuramoyl residues and L-amino acid residues in bacterial cell wall glycopeptides, and thus may play a scavenger role by digesting biologically active peptidoglycan into biologically inactive fragments. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for disruption of this gene are viable and fertile with no gross developmental defects. Mice homozygous for a different knock-out allele are resistant to peptidoglycan- or muramyl dipeptide-induced arthritis and increased susceptibility to DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,896,461 V194A probably damaging Het
Adamts13 G A 2: 26,986,679 probably null Het
Ahnak T C 19: 9,011,144 M3264T possibly damaging Het
Birc6 T A 17: 74,599,340 C1409S probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Dnah2 A G 11: 69,447,861 V3161A probably damaging Het
Dnah5 A T 15: 28,383,581 Y2983F probably damaging Het
Dnah6 G A 6: 73,083,124 L2774F probably damaging Het
Dst A T 1: 34,217,836 T4398S probably damaging Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
Efcab5 A T 11: 77,172,378 M96K probably benign Het
Elavl4 A G 4: 110,206,705 probably benign Het
Flt4 G A 11: 49,644,386 A1214T probably benign Het
Fn1 G T 1: 71,595,786 T2127N probably damaging Het
Foxj1 A T 11: 116,331,803 S391R possibly damaging Het
Gabrb1 A T 5: 72,108,807 Y269F probably damaging Het
Ghitm A G 14: 37,125,911 S259P possibly damaging Het
Gm16332 A G 1: 139,924,190 noncoding transcript Het
Gm16380 T A 9: 53,884,443 noncoding transcript Het
Gm9869 A T 9: 60,838,062 probably benign Het
Gm9936 G A 5: 114,857,131 Q142* probably null Het
Hmbs T C 9: 44,337,008 Y260C probably benign Het
Hoxc5 T A 15: 103,015,352 C193* probably null Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Lce1j T C 3: 92,789,388 K28E unknown Het
Lpgat1 C T 1: 191,719,348 probably benign Het
Lyst T C 13: 13,708,214 probably benign Het
Megf11 A G 9: 64,640,078 N235D probably damaging Het
Mst1r T A 9: 107,916,804 probably null Het
Nr2c2ap A G 8: 70,131,587 D9G probably benign Het
Obscn T C 11: 59,136,339 T13A probably damaging Het
Ofcc1 A C 13: 40,214,474 L188* probably null Het
Olfr1028 A G 2: 85,951,873 E270G probably damaging Het
Olfr432 A T 1: 174,050,399 T9S probably benign Het
Oma1 A T 4: 103,325,201 probably benign Het
Pcm1 T C 8: 41,316,023 F1642S probably damaging Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Prdm10 C A 9: 31,316,300 T67K probably damaging Het
Ralgapa1 A T 12: 55,708,067 H1193Q probably benign Het
Sall1 A G 8: 89,032,604 S291P probably damaging Het
Sdk2 T C 11: 113,893,464 T150A probably damaging Het
Sel1l2 T A 2: 140,275,441 Y170F probably benign Het
Sema4a C T 3: 88,436,800 V715I possibly damaging Het
Smgc G A 15: 91,854,638 A500T probably benign Het
Spef2 A G 15: 9,584,062 V1639A probably damaging Het
Srrm4 A G 5: 116,482,378 probably benign Het
Tbc1d23 G A 16: 57,189,273 H418Y probably damaging Het
Tbk1 A G 10: 121,584,254 L10P probably damaging Het
Thumpd3 G A 6: 113,065,660 probably null Het
Trp53bp1 G T 2: 121,204,943 T1609K probably damaging Het
Tut1 A G 19: 8,955,555 N84S probably benign Het
Urb1 C T 16: 90,796,399 G282R probably damaging Het
Usp19 A T 9: 108,499,711 D1160V probably damaging Het
Usp9y A G Y: 1,316,933 V1872A probably damaging Het
Zfp276 C A 8: 123,259,503 Y386* probably null Het
Other mutations in Pglyrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:Pglyrp2 APN 17 32418577 missense probably benign 0.14
IGL01949:Pglyrp2 APN 17 32416106 splice site probably null
IGL02355:Pglyrp2 APN 17 32417022 missense probably damaging 1.00
IGL02362:Pglyrp2 APN 17 32417022 missense probably damaging 1.00
IGL02601:Pglyrp2 APN 17 32415861 missense probably benign 0.04
IGL02965:Pglyrp2 APN 17 32418586 missense probably benign 0.00
R0324:Pglyrp2 UTSW 17 32418328 missense probably benign 0.00
R2158:Pglyrp2 UTSW 17 32418248 missense probably benign 0.12
R2181:Pglyrp2 UTSW 17 32418962 missense probably damaging 1.00
R2191:Pglyrp2 UTSW 17 32415957 missense probably benign 0.04
R2313:Pglyrp2 UTSW 17 32418699 missense probably damaging 1.00
R4825:Pglyrp2 UTSW 17 32418261 missense probably benign 0.00
R4852:Pglyrp2 UTSW 17 32415849 missense probably benign 0.09
R4888:Pglyrp2 UTSW 17 32418797 missense probably benign 0.26
R6941:Pglyrp2 UTSW 17 32416074 missense probably damaging 1.00
R7014:Pglyrp2 UTSW 17 32415930 missense probably damaging 0.98
R7327:Pglyrp2 UTSW 17 32415919 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ATGTAAGGTGCCAGCATGGCAG -3'
(R):5'- TGGAGTGTGAACTTCCCAGTCTACG -3'

Sequencing Primer
(F):5'- CCAGCATGGCAGTTTGCTAAG -3'
(R):5'- CAGGGACCTGTCTTGTTGACC -3'
Posted On2013-08-08